中国P站

ISSN: 2161-0681
Journal of Clinical & Experimental Pathology
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.

CK19 Detection by Multiplex Real-Time RT-PCR Correlates with the Presence of Angiolymphatic and Perineural Invasion in Sentinel Lymph Nodes of Thai Breast Cancer Patients

Tanawan Kummalue1, Monthira Suntiparpluacha2, Kannika Tongkao1, Tuenjai Chuangsuwanich3, Tawatchai Pongpruttipan3 and Pornchai O-charoenrat4*

1Department of Clinical Pathology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand

2Medical Molecular Biology Unit, Office for Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand

3Department of Pathology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand

4Department of Surgery, Division of Head&neck, Breast Surgery, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand

*Corresponding Author:
Pornchai O-charoenrat
Department of Surgery, Division of Head&neck
Breast Surgery, Faculty of Medicine Siriraj Hospital
Mahidol University, Bangkok, Thailand
Tel: (66)24198016
Fax: (66)24129160
E-mail: sipoc@mahidol.ac.th

Received Date: June 7, 2012; Accepted Date: July 30, 2012; Published Date: August 03, 2012

Citation: Kummalue T, Suntiparpluacha M, Tongkao K, Chuangsuwanich T, Pongpruttipan T, et al. (2012) CK19 Detection by Multiplex Real-Time RT-PCR Correlates with the Presence of Angiolymphatic and Perineural Invasion in Sentinel Lymph Nodes of Thai Breast Cancer Patients. J Clin Exp Pathol 2:122. doi: 10.4172/2161-0681.1000122

Copyright: © 2012 Kummalue T, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Clinical & Experimental Pathology

Abstract

Abstract
Background: Pathological evaluation of sentinel lymph nodes of breast cancer patients is a critical factor in
determining the treatment strategy including patients’ outcome. Multiple factors have been known to correlate with
disease free survival and clinical outcomes such as sentinel lymph node metastases. Recently, real-time RT-PCR
which is a very useful, rapid, high sensitivity and specificity tool has been reported to detect micrometastases in
sentinel lymph nodes which could be helpful to identify high risk patients.
Objectives: The purpose of this study are: To evaluate the sensitivity, specificity, and accuracy of CK19
detection by multiplex real-time RT-PCR and to elucidate the correlation of multiplex real-time RT-PCR results and
clinicopathological parameters in sentinel lymph nodes of Thai breast cancer patients.
Material and methods: 119 patients diagnosed as breast cancer stage I or II at Siriraj Hospital during October
2008 – June 2010 were enrolled in this study. RNAs were extracted from their sentinel lymph nodes and cDNAs were
synthesized. Multiplex real-time RT-PCR for detection of CK19 was performed and analysed. Patients’ characteristics
and pathological parameters were compared with multiplex real-time RT-PCR results.
Results: Significant correlation between angiolymphatic and perineural invasion status and CK19 expression was
demonstrated. The overall concordance of CK19 gene with pathological results was 72.3%. Sensitivity and specificity
for CK19 detected by multiplex real-time RT-PCR were 78.3%, and 66.1%, respectively.
Conclusion: Significant correlation between angiolymphatic and perineural invasion status and CK19 expression
in sentinel lymph nodes of breast cancer patients was found in this study.

Keywords

Angiolymphatic; Cytokeratin 19; Multiplex Real-Time RT-PCR; Axillary lymph nodes; Breast cancer

Background

Breast cancer, which is the leading cause of female cancer in Thailand, has a high mortality rate due to metastatic disease [1]. According to the previous report, 5-year overall survivals for Thai breast cancer patients at stage I, II, III, and IV were 100%, 88.5%, 64.3%, and 27.3%, respectively [2]. Pathological evaluation of the axillary lymph nodes especially sentinel lymph nodes metastases is considered to be one of the most valuable factors in determining the strategic treatment, prognosis, and patient’s outcome [3]. The standard method for identifying lymph node micrometastatic status is hematoxylin and eosin (H&E)-stained sections combination with immunohistochemical staining. However, real-time RT-PCR has been reported to increase sensitivity, and accuracy to detect the micrometastases which is helpful to identify high risk patients who will gain benefit from aggressive systemic therapy [4].

Cytokeratin 19 (CK19) is a part of the cytoskeleton of epithelial cells known to express in epithelial tumors and in all breast cancers [5]. CK19 has been reported before to be the superior marker for breast cancer especially in metastatic disease in sentinel lymph nodes [6-8]. Based on previous data, it has also been demonstrated as a highly sensitive marker for the detection of micrometastases in axillary lymph nodes and breast cancer cells in peripheral blood by using realtime RT-PCR [9-13]. Interestingly, correlation of CK19 positive cells in the peripheral blood with breast cancer patients stage I or II was demonstrated as a marker of poor clinical outcome [14].

In this study, we conducted the CK19 detection by multiplex realtime RT-PCR from sentinel lymph nodes of breast cancer patients at Siriraj Hospital. Evaluation of the correlation between multiplex realtime RT-PCR results and patients’ clinicopathological parameters was performed to determine the significant poor prognostic features in breast cancer patients.

Materials and Methods

Patient’s samples

Patients diagnosed as breast cancer using routine histopathological sections at Department of Surgery, Faculty of Medicine Siriraj Hospital, Mahidol University, during October 2008 – June 2010 were enrolled in this study. Inclusion criteria were as followed; age ≥ 20 years old, tumor size category of T1-T3, ECOG (Eastern Cooperative Oncology Group) performance status of 0-2, no evidence of distant metastasis and no previous chemo-hormonal therapy. Patients diagnosed as Ductal Carcinoma In Situ (DCIS), Lobular Carcinoma in situ (LCIS) were not included in this study. Tissue specimens from sentinel lymph nodes were bisected and one half was used to evaluate the metastatic condition by pathologists. The other portion from the same tissue was stored in RNAlater® (Qiagen, Germany) at -80oC until the RNA extraction process could be performed.

This study was conducted in accordance with the Declaration of Helsinki and was approved by The Siriraj Institutional Review Board (SIRB). All patients provided written informed consent.

Cell line and culture

SKBR3 breast cancer cell line from American Type Culture Collection was used to generate standard curve. Cells were maintained in Dulbecco’s Modified Eagles Medium (Gibco, Thailand) supplemented with 10% fetal bovine serum (Gibco, Thailand) and 1% penicillinstreptomycin (Gibco, Thailand) at 37°C, with 5% CO2 in a humidified incubator. Cells were harvested and counted using hemocytometer.

Total RNA Isolation and cDNA Synthesis

Total cellular RNA isolation from sentinel lymph nodes and SKBR3 breast cancer cell line were performed using RNeasy Mini Kit following the manufacturer’s instruction. In brief, the sentinel lymph nodes weight approximately 30 mg were transferred to the tubes prefilled with Buffer RLT and 1.4 mm ceramic beads and were disrupted using FastPrep Automated homogenizer (MP Biomedicals LLC, USA) at 6 m/s for 20 sec. The lysate was centrifuged at 13,000 rpm for 3 min. Then the supernatant was transferred into spin column and washed three times with Wash Buffer. RNA was eluted with 30 μl RNAse-free water. Total RNA concentration and purity were measured using NanoDrop 1000 spectrophotometer V.3.7 (Thermo Scientific, USA).

Reverse transcription of RNA was carried out with Transcriptor High Fidelity cDNA Synthesis Kit (Roche Diagnostics) following the manufacturer’s protocol. cDNA was synthesized from 4 μg of total RNA template in the reaction volume of 20 μl. PCR reaction was set at 55°C, 60 min and 85°C, 5 min. with random hexamer primer at 60 μM on a thermal cycler (Biorad, USA). RNA integrity was evaluated in the cDNA preparation by PCR amplification of the human Hypoxanthine Guanine Phospho Ribosyl Transferase (HPRT) gene (Roche Diagnostics) according to the manufacturer’s instructions.

Multiplex real-time RT-PCR

The real-time RT-PCR primers and probes of CK19, and PBGD genes were designed and synthesized by TIB MOLBIOL® as shown in (Table 1). PBGD is used as a reference gene since it is a housekeeping gene that is expressed wildly and stably in the cells. The multiplex realtime RT-PCR was performed using LightCycler 2.0 glass capillaries (Roche diagnostics) in a total volume of 20 μl. For the CK19 PCR, 4.2 μl of cDNA, 0.20 μM probes, 0.65 μM Primer CK19 forward and 0.50 μM Primer CK19 reverse, and 1x master mix were added up to the final volume. For PBGD, 0.60 μM primer PBGD forward and 0.50 μM primer PBGD reverse were used in the reaction. The cycling protocol consisted of initial denaturation at 95°C for 10 min followed by 45 cycles of 95 °C for 15 sec, 55°C for 15 sec with monitoring of fluorescence signals and 72°C for 8 sec with slope at 20°C/sec, and the last step was 40°C for 30 sec for a cooling down. CK19, and PBGD expressions were detected at 610 nm, and 640 nm, respectively. Absolute Quantification (Colour compensation) and relative quantification-monocolour module (Color compensation) were analyzed with the LightCycler Software 4.1 to calculate gene expression concentrations and concentration ratios between target and reference genes expression.

Gene Primer/Probe Oligonucleotide sequence (5’-3’)
CK-19 CK19 forward GCACTACAGCCACTACTACACGA
  CK19 reverse CTCATGCGCAGAGCCTGTT
  CK19 FLa TGTCCTGCAGATCGACAACGCCC
  CK19 LCb CTGGCTGCAGATGACTTCCGAACC
PBGD PBGD forward GCTGCAACGGCGGAA
  PBGD reverse CCTGTGGTGGACATAGCAATGATT
  PBGD FLa TCGCATACAGACGGACAGTGTGGTG
  PBGD LCb CAACATTGAAAGCCTCGTACCCTGG

Table 1: Sequences of primers and probes used in real-time RT-PCR.

Standard curve construction

Standard curve of each gene was generated separately with each thermocycler run of the samples. cDNA used for building the standard curve was from SKBR3 cell line. These standard curves were used for gene expression concentrations calculation for each run by setting as an external standard. In brief, total RNA from 1×107 SKBR3 breast cancer cell line was prepared and cDNA was synthesized. Four-fold serial dilutions correlated with cells at concentrations of 1×102-1×106cells were prepared and further run by real-time RT-PCR. The standard curve was created by plotting various concentrations of cDNA of each gene gained from SKBR3 cells versus crossing point (Cp) value. PCR results were determined with LightCycler software 4.1 using Absolute quantification (colour compensation) module.

Receiver operator characteristic (ROC) curve analysis of cancer-associated genes

Concentration ratio values, true positive rate and false positive rate from matched control normal and metastatic breast cancer data sets were analyzed using SPSS program. A concentration ratio that gives the highest sensitivity plus specificity was chosen to be the cut-off value.

Statistical analysis

Patients’ pathological results, clinical information and real-time RT-PCR results were analyzed using Chi-square test in order to find correlations between CK19 expression and patients’ clinicopathological status. The p-value less than 0.05 is considered a significant relationship.

Results

Patient histopathological characteristics

Sentinel Lymph Nodes (SLNs) from 159 operable female patients undergoing modified radical mastectomy for invasive breast cancer were obtained from one institution, Siriraj Hospital, Mahidol University. Patient ages ranged from 27 to 83 years. Of these, 119 patients were analyzed, and clinicopathological findings were shown in (Table 2). Forty patients were excluded from the final analysis due to the following reasons. The first most common reason was the inability to obtain adequate RNA from tissues, and the second was the final diagnosis of DCIS, and LCIS.

  All patients  
  N %
Patients enrolled 119  
Age, years 51
68
53.5
52
42.9
57.1
≤ 50
> 50
Mean
Median
Tumor type 100
4
3
3
10
83.3
3.3
2.5
2.4
8.5
IDC
ILC
IDC+ILC
Others
Not reported
Tumor size, cm 33
50
24
12
27.7
42.0
20.2
10.1
0-1.9
2-3.9
≥ 4
Not reported
Tumor grade 5
49
2
45
12
4.2
40.8
1.7
37.5
10
1
2
2-3
3
Not reported
Metastatic size, mm 52
0
2
65
43.7
0
1.7
54.6
0
< 0.2
0.2-2
> 2
Angiolyphatic invasion   39
54
26
  32.8
45.4
21.8
Involved
Not involved
Not reported
Perineural invasion 16
57
46
13.4
47.9
38.7
Involved
Not involved
Not reported
Nipple/Skin involvement 4
77
38
3.4
64.7
31.9
Involved
Not involved
Not reported
Resection margin 41
67
11
34.5
56.3
9.2
Free
Not free
Not reported
Estrogen receptor   68
38
13
  57.1
34.5
9.2
Positive
Negative
Not reported
Progesterone receptor   61
45
13
  51.3
37.8
10.9
Positive
Negative
Not reported
HER2/neu 31
22
31
21
14
26.1
18.5
26.1
17.6
11.8
1+
2+
3+
Negative
Not reported

Table 2: Patients’ clinicopathological information.

Standard curve analysis

The standard curves were constructed and used for calculation the concentrations by LightCycler 4.1 software.

Quantitation of CK19 Gene Expression in Lymph Nodes and ROC Curve Analysis

To determine the base line expression of CK19 gene, 53 normal lymph nodes and 66 positive lymph nodes were analyzed by multiplex real-time PCR. Concentration ratio between target gene and reference gene of all samples was also calculated by the same software using the standard curves data. Cut-off value of CK19 expression was 0.025.

Comparison of Lymph Node Status Results from multiplex Real-Time RT-PCR to Results from Routine Histopathological Analysis

The comparison of pathological and multiplex real-time RT-PCR results in respect to CK19 expression are presented in (Table 3). The overall concordance of CK19 with the histopathological findings was approximately 72.3%. In particular, 15 cases were identified as positive by the multiplex quantitative RT-PCR assay for CK19, while histopathological sections showed negative for malignancies. Interestingly, 21 cases showed CK19 negative by RT-PCR whereas pathological sections revealed positive results.

Nodal status CK19
(cut-off value = 0.025)
  Positive Negative
Positive for malignancy 47 13
Negative for malignancy 20 39
Accuracy (%)
Sensitivity (%)
72.3
78.3
Specificity (%) 66.1

Table 3: Accuracy, sensitivity, and specificity of multiplex real-time RT-PCR of CK19 (LightCycler 2.0, Roche).

Sensitivity and specificity of multiplex real-time RTPCR

Calculation of the sensitivity and specificity was done using SPSS program. Sensitivity is true positive result whereas specificity is true negative result comparing with the total number. As shown in (Table 3), the sensitivity and specificity for CK19 gene were 78.3% and 66.1% respectively, with 72.3% accuracy.

Correlations of multiplex real-time PCR results and patients’ clinicopathological status

Using Chi-square test for analysis, age of patient, tumor size, cancer type, differentiation stage, nipple-skin involvement, resection margin, and PR/ER/Her2 status have no significant effect on CK19 expression in sentinel lymph node metastatic breast cancer patients. Twenty-eight (71.8%) and 13 (81.3%) of patients presented angiolymphatic and perineural invasion, respectively, showed positive CK19 PCR results while only 11 (28.2%) and 3 (18.8%) of samples with angiolymphatic and perineural invasion, respectively, showed negative CK19 PCR. Therefore, we found significant correlation between angiolymphatic (p=0.02) and perineural (p=0.034) invasion status and CK19 PCR results.

Discussion

The overall concordance of CK19 expression with pathological sections in our study was 72.3%. Compare to previous report, the concordance of the CK19 expression with histological status was 71% [15]. Therefore, our result is consistent with other report. In pathological negative results with positive detection by multiplex realtime RT-PCR, the submicroscopic metastases might be the cause. It is still in controversy whether nodes with pathological negative results but positive for real-time RT-PCR will have further significance in clinical setting. These evidences should be determined further in a long term follow up in this breast cancer group. Perhaps, this positive detection by real-time RT-PCR could help in prognosis of these patients in the future.

In contrast, nodes with positive pathological sections but real-time RT-PCR showed the negative results, these false negative results might cause by several reasons. Most of all, the multiplex real-time RT-PCR could induce more interference in the reaction itself. Hybridization and different probes with dyes including the several pairs of primers in one tube can interact to each other, thus, cause the failure to amplify the indicated genes resulting in negative response of real-time RT-PCR [16]. Moreover, the degradation of RNA extracted from the breast tissues might be another reason.

Nowadays, the prognostic features determining the clinical outcome in breast cancer patients are estimated by staging and pathological parameters such as tumor size, tumor hormone receptor, and lymph node involvement. Of all these factors, nodal involvement and tumor size are the strongest predictors for patient’s survival and treatment outcome, whereas other factors such as angiolymphatic invasion has been demonstrated to have prognostic significance for local and distant recurrence risk including overall survival [17]. In our study, correlations between age of patient, tumor size, cancer type, PR-ER and Her2/neu status were calculated using Chi-square test to see whether these patients status would affect the expression of CK19. Interestingly, the results showed the significant association between CK19 PCR results and angiolymphatic and perineural invasion.

Angiolymphatic Invasion, or Lymphovascular Invasion (LVI), has been known to correlate with high recurrence rate in breast cancer patients as mentioned earlier. 38% recurrence rate was found in LVI positive stage I patients when compared with 22% recurrence rate of patients who have LVI negative disease [18]. Based on our data, Perineural Invasion (PNI) also has significant correlation with CK19. PNI is a less common feature found in breast cancer tissue when compared with LVI. It represents high tumor stage, high tumor grade, and LVI in breast cancer. However, its role as a poor prognostic factor in breast carcinoma is not well established [19].

Conclusion, in this study, the significant correlation between angiolymphatic and perineural invasion and CK19 gene expression was demonstrated. CK19 detection by multiplex real-time RT-PCR, which is a powerful and rapid tool, might be useful for fast determination of the high risk breast cancer patients who might have chance for disease recurrence and who will gain benefit for aggressive breast cancer therapy.

Acknowledgements

This work was supported by National Research Councils of Thailand (NRCT) and Faculty of Medicine Siriraj Hospital, Mahidol University, Thailand.

References

--
Post your comment

Share This Article

Article Tools

Article Usage

  • Total views: 14950
  • [From(publication date):
    September-2012 - Jun 10, 2026]
  • Breakdown by view type
  • HTML page views : 10194
  • PDF downloads : 4756
International Conferences 2026-27
 
Meet Inspiring Speakers and Experts at our 3000+ Global

Conferences by Country

Medical & Clinical Conferences

Conferences By Subject

Top Connection closed successfully.