ÖйúPÕ¾

ISSN: 2332-2608
Journal of Fisheries & Livestock Production
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.

Association of Chicken Fatty Acid Desaturase 1 and 2 Gene Single- Nucleotide Polymorphisms with the Fatty Acid Composition of Thigh Meat in Japanese Hinai-dori Crossbred Chickens

Rikimaru K1, Egawa Y2, Yamaguchi S2,3 and Takahashi H4*

1Akita Prefectural Livestock Experiment Station, Daisen 019-1701, Japan

2Oils and Fats Fundamental Technology Laboratory, J-OIL MILLS, Inc., Yokohama 230-0053, Japan

3Institute of Food Sciences and Technologies, Ajinomoto Co., Inc., Kawasaki 210-8681, Japan

4Institute of Livestock and Grassland Science, NARO, Tsukuba 305-0901, Japan

*Corresponding Author:
Takahashi H
Institute of Livestock and Grassland Science
NARO, Tsukuba, Ibaraki 305-0901, Japan
Tel: +81-29-838-8623
E-mail: naoe@affrc.go.jp

Received Date: October 07, 2016; Accepted Date: October 13, 2016; Published Date: October 20, 2016

Citation: Rikimaru K, Egawa Y, Yamaguchi S, Takahashi H (2016) Association of Chicken Fatty Acid Desaturase 1 and 2 Gene Single-Nucleotide Polymorphisms with the Fatty Acid Composition of Thigh Meat in Japanese Hinai-dori Crossbred Chickens. J Fisheries Livest Prod 4:202 doi: 10.4172/2332-2608.1000202

Copyright: © 2016 Rikimaru K, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Fisheries & Livestock Production

Abstract

Hinai-jidori chicken, a cross between Hinai-dori (a breed native to Akita Prefecture, Japan) sires and Rhode Island Red dams, is a popular chicken brand in Japan. We previously reported that a high arachidonic acid (ARA) content is a characteristic feature of Hinai-jidori chicken and demonstrated that chicken meat with higher ARA contents had a much better taste perception than that with low ARA contents using Hinai-jidori and broiler chickens. To investigate the genes affecting fatty acid profiles, including ARA, in Hinai-jidori chicken, we genotyped polymorphisms of the fatty acid desaturase 1 and 2 (FADS1 and FADS2) genes and investigated their association with the fatty acid profile in Hinai-jidori meat. 5′-flanking regions, all the exons, and 3′-untranslated regions of the FADS1 and FADS2 genes in three chicken breeds, i.e., Hinai-dori, Rhode Island Red, and White Plymouth Rock, were amplified via PCR, after which their nucleotides were sequenced and SNPs were identified. Of the 71 and 46 SNPs found in the FADS1 and FADS2 genes, respectively, two SNPs were chosen from each gene, and their associations with fatty acid profiles of Hinai-jidori meat were analyzed. Hinai-jidori female chickens hatched on the same day and reared under identical environmental conditions for the same duration were used in this study. In each SNP of FADS1 and FADS2, the ARA and docosahexaenoic acid (DHA) compositions were significantly higher in the G than in the A allele, respectively. Moreover, an association of FADS1 and FADS2 haplotypes with the fatty acid composition was observed. For example, the ARA and DHA composition of the G-G-haplotype were significantly higher than those of the A-A-haplotype. Thus, we concluded that SNPs in the FADS1 and FADS2 gene cluster are useful to increase ARA and DHA, and can be used to develop strategies for improving the taste of Hinai-jidori chicken.

Keywords

Hinai-jidori chicken; Marker gene; Fatty acid desaturase 1; Fatty acid desaturase 2; Fatty acid profile

Introduction

Globally, most chicken meat is obtained from limited fast-growing broiler strains provided by commercial breeding companies that use intensive fatting systems to ensure high meat yields. Meanwhile, some consumers are willing to pay a high selling price for better quality chicken meat, known as “Jidori” chicken in Japan. Most Jidori chickens were initially bred by crossing native Japanese breeds with highly selected lines with rapid growth. Since Jidori chickens require a relatively long growing time at a considerably high production cost, their selling price can be 2-5 times more than that of broilers. The Hinai-jidori chicken, a cross between Hinai-dori (a chicken breed native to the Akita Prefecture of Japan) sires and Rhode Island Red dams, is a popular brand of Jidori chicken in Japan [1].

A sensory evaluation report showed increased palatability of the Hinai-jidori chicken over broiler chickens [2]. Past studies showed that free amino acid (FAA) contents, including glutamic acid (Glu) [3] and inosine 5′-monophosphate (IMP) [4] could be correlated with chicken meat palatability. For example, Matsuishi et al. [3] reported that chicken soup made from broiler chicken is more palatable than that from a Jidori chicken brand (Nagoya Cochin), suggesting that it reflects the high FAA content of broiler meat; however, most Japanese consumers recognize that Jidori meat is more palatable than broiler meat. These authors removed the fat from the chicken soup and then subjected the soup to a sensory evaluation; thus, we speculated that fat contains key substances. To define candidate substances related to chicken meat palatability, we reared Hinai-jidori and broiler chickens under identical environmental and time conditions, and then compared the meat quality traits, e.g., FAA and IMP content and fatty acid composition, of their thigh meat. We concluded that high arachidonic acid (ARA, C20:4n-6) and docosahexaenoic acid (DHA, C22:6n-3) content is characteristic of Hinai-jidori chicken meat [2]. Then, we demonstrated that ARA content in chicken meat could be manipulated by an ARA diet supplement in Hinai-jidori [5] and broilers [6], and chicken meat containing higher levels of ARA tasted much better than that containing low ARA contents. Koriyama et al. [7] reported that DHA suppressed sourness and bitterness, but increased sweetness and umami tastes. These data suggest that ARA and DHA are fundamental for the taste perception of chicken meat.

ARA originates from both dietary sources and the elongationdesaturation process of its precursor, linoleic acid (LA, C18:2n-6). The δ-5 (D5D) and δ-6 (D6D) desaturases are key enzymes involved in this pathway (Figure 1) [8]. D6D catalyzes the conversion of LA to γ-linolenic acid (GLA, C18:3n-6), which is then elongated to dihomo γ-linolenic acid (DGLA, C20:3n-6) by elongases (Figure 1). In turn, C18:3n-6 is desaturated to ARA by D5D. D6D, D5D, and elongases are also involved in the n-3 fatty acid pathway (Figure 1), which favors the conversion of α-linolenic acid (ALA, C18:3n-3) into DHA. D5D and D6D are encoded by fatty acid desaturase 1 and 2 genes (FADS1 and FADS2), respectively. The FADS1 and FADS2 genes are clustered in a back-to-back direction on chicken chromosome 5 [9,10]. Therefore, we speculated that FADS1 and FADS2 are the key genes that control both ARA and DHA in chicken meat.

fisheries-livestock-production-pathway

Figure 1: Synthetic pathway of long chain unsaturated fatty acids (D6D: δ-6 desaturase; D5D: δ6 desaturase; e: elongases).

Our main objective in this study was to analyze the polymorphism of the FADS1 and FADS2 genes and test its association with the fatty acid profiles of Hinai-jidori chickens to effectively understand why Hinai-jidori meat has high ARA and DHA contents.

Materials and Methods

Identification of DNA polymorphisms of FADS1 and FADS2

A draft sequence of the chicken genome, available in established databases [9,10], was used in the present study. To detect DNA polymorphisms of FADS1 and FADS2, unrelated chickens belonging three breeds, i.e. Hinai-dori (3 individuals), Rhode Island Red (3), and White Plymouth Rock (3), were used. Hinai-dori and Rhode Island Red breeds were used, since they are the parents of Hinai-jidori chickens. White Plymouth Rock, which is a founder of broiler chickens, was used as an outlier breed.

The blood samples were collected from the ulnar vein. Genomic DNA was purified from blood using the SepaGene kit (EIDIA, Tokyo, Japan). The nucleotide sequences of the regulatory regions (promoters and 5′ and 3′ UTRs) and twelve exons each of FADS1 and FADS2 in the nine individuals were determined by polymerase chain reaction (PCR) amplification followed by direct sequencing using the same procedure as described previously [11]. Primers for the PCR and direct sequencing were listed in Table 1. The DNA sequences of the FADS1 and FADS2 genes were analyzed using the GENETYX program (Software Development Co., Tokyo, Japan) and DNA polymorphisms were identified. Linkage disequilibrium (LD) block analysis and haplotype estimation were performed using Haploview software [12].

Set Locus Forward (5′→3′) Reverse (5′→3′) Product (bp) Annealing
³Ù±ð³¾±è±ð°ù²¹³Ù³Ü°ù±ðã??(&»å±ð²µ;°ä)
FADS1 gene        
1 5′ UTR and Exon 1 GCGGGCCAATGGGCGTGGAG TTCCTTACGGAGCGCGCAGCTGA 458 68
2 Exon 2 GCAGCAATATCAGATCCTGCCAA TTGGGTTTGAGAAGCCCCATCT 651 60
3 Exon 3 AGTCAGCTAAGAAAGTATCCCGGAA AGCATGAAGCCTGCTCTACCAA 587 61
4 Exon 4 AAGCAAAGGCTCCTAGCTCTTCT GAGGCAGAAATGAGAATACAGTGCC 332 61
5 Exon 5 CTGTTCTCCTGGGTAACTGTG CCAAACCAACTGGTCTCTTGT 501 57
6 Exons 6 and 7 CACATCCAAGGCAGGGAGAA CCACCAAACATTCTCTCCCTGA 634 59
7 Exon 8 GGTGTGATGTGGTTGTCCAG CAGACGGAAAAGATAACCAGGAG 647 58
8 Exon 9 ACAAGTGCTTTGTACTGACTCGTT GCTGCTGTGATCAGCTCTCTTG 251 60
9 Exon 10 GTTGTGTCTGACTCGTGTAAGAGAA GTACCTAATCTCAGGAGGCACATAG 503 60
10 Exon 11 GTAGGGGAACTCTGCAAGGCAA CTCTACGTCCCTTGCTTGTTCACTC 257 62
11 Exon 12 and 3′ UTR CTCTCTTCTACCACGCTTGCTC TTCATCACTGGAATTAAGCTGTGTC 447 59
FADS2 gene        
12 5′ UTR and Exon 1 CGTGCCGTCGGGGCGAGGGT GCGTGCTCCCCGGCATGCCCTAA 930 71
13 Exon 2 AATTGGAAGGGGCTCTTAAAGGCCA GGATCCCTATTGCTCCTACCGCTT 594 64
14 Exon 3 TGGTGTAGCCAAACAAAGCAAGA GAAGGAAAGGCACGGGAGATAAG 516 60
15 Exons 4 and 5 TGTCTATTTTCTTTCATGCTCAACT TCTTAGCACTCTTGTAAGCGG 642 56
16 Exon 6 AATACAAAGAAGCTGTCAGCATCA CCAGAGGTTACTTCCCAGTCTC 554 58
17 Exons 7 and 8 AGCACATCACTTCTTACACCA ATAAAACAACACAGTGTGGCAAA 621 56
18 Exon 9 GGGATAATTGCATTAGTCCAG GTCTTATCCAACCTTAACGATT 530 54
19 Exon 10 TAAAGCTTCCCATGCTGCAGT GAGAAGGTGTTAGGCAATCTCGT 475 60
20 Exon 11 CAGCAGGAGAATCGACGTATTC GTAGTGACACCAGATTACAAAACAC 468 58
21 Exon 12 and 3′ UTR CTCAGACTGAGTAACAGAGTTCTCC CATTTGCGGTTACACGCGATT 666 59

Table 1: Primers for chicken fatty acid desaturase 1 (FADS1) and fatty acid desaturase 2 (FADS2) sequencing.

Hinai-jidori chicken samples

Unrelated female Hinai-jidori chickens (32 individuals) were raised in the Akita Prefectural Livestock Experiment Station. The chicks hatched on the same day were housed in an open-sided poultry shed and given access to a grass paddock until 22 wk of age. Chicks were fed a starter diet (ME, 3,000 kcal/kg; CP, 24% [wt/wt]) from 0 to 4 wk, grower diet (ME, 2,850 kcal/kg; CP, 18%) from 5 to 10 wk,and finisher diet (ME, 2,900 kcal/kg; CP, 16%) from 11 to 22 wk; the diets were specially prepared for Hinai-jidori chickens (Kitanihon Kumiai Feed Co., Sendai, Japan). Water and feed was provided and libitum for the duration of the experiment. All animals received human care as outlined in the Guidelines for Proper Conduct of Animal Experiments [13].

At 22 wk of age, the chickens were fasted for 18 h, and then slaughtered. The chickens were bled and plucked; their carcasses were manually eviscerated and washed, followed by immediate cooling in ice-cold water until a temperature of 8°C was reached. They were then removed from the water and drained for 10 min. Carcasses were dissected and the thigh meat was deboned after skin removal; the thigh meat from one leg was minced using a domestic meat chopper (No.5-A, Veritas, Tokyo, Japan). Meat samples were stored at -30°C until further analysis.

Determination of fatty acid composition of the thigh meat

To determine fatty acid profiles, we extracted lipids from 0.1 g of each minced meat sample using 3 mL chloroform:methanol (2:1, v/v) according to the method described by Iverson et al. [14]. The extract was thoroughly mixed with 1.5 mL hexane. Following the addition of 200 μL 2 M potassium hydroxide in methanol, the contents were vortexed for 30 s. Next, 2 ml saturated sodium chloride solution was added and mixed thoroughly. The sample was then centrifuged at 1,000×g for 5 min, and the supernatant containing fatty acid methyl esters was recovered. The fatty acid methyl esters were separated using a GC2010 Gas Chromatograph (Shimadzu Co., Kyoto, Japan) and capillary column (DB-23, Shimadzu) (length=30 m, i.d.=0.25 mm, and film thickness=0.25 μm). The column was set at an initial temperature of 80°C for 2 min, then increased from 80 to 160°C at 35°C/min, 160 to 185°C at 2°C/min, followed by 10°C/min to a maximum temperature of 230°C, which was maintained for 9 min. Other conditions included the following: injection port temperature, 250°C; flame ionization detector temperature, 250°C; helium flow rate, 1.49 ml/min. The fatty acids were identified by comparison of retention times with FAME Mix Equity1 (Sigma-Aldrich Co., St. Louis, MO, USA).

Statistical analysis

Comparisons between two groups were performed using a Student’s t-test. Comparisons among groups were performed using Tukey’s multiple-comparison test. Haplotypes were inferred using the Thesias program [15] that is designed for testing haplotype effects in unrelated subjects when adjusting for covariates. This computer program is based on the maximum likelihood model described by Tregouet et al. [16]. Differences between the groups were considered significant when P < 0.05.

Results

Seventy-one and forty-six SNPs were found in the FADS1 and FADS2 genes, respectively (Tables 2 and 3). Of the SNPs, seven have not been previously identified. The nucleotide sequences containing the new SNPs were registered in the DNA data bank of Japan (DDBJ) and the accession numbers of the sequences containing the new SNPs are shown in Tables 2 and 3. All SNPs found in the coding regions of the FADS1 and FADS2 genes were synonymous substitutions without changing amino acids. No LD blocks were detected in FADS1 (Figure 2), whereas an LD block was detected between the 5′-upstream region and intron between exons 1 and 2 in FADS2 (Figure 3).

No. Location and characteristics SNP_ID (accession number in DDBJ) Base position in chicken chromosome 5
1 5′ upstream rs737673984 16770615
2 5′ UTR rs316315792 16770519
3 Exon1 rs733003230 16770503
4 Exon1 NR1 (LC061130, g.233 C > T) 16770386
5 Intron between exons 1 and 2 rs735910165 16770292
6 Intron between exons 1 and 2 NR (LC061130, g.327 C > T) 16770238
7 Intron between exons 1 and 2 rs316695951 16768904
8 Intron between exons 1 and 2 rs315355848 16768883
9 Intron between exons 1 and 2 rs739885036 16768857
10 Intron between exons 1 and 2 rs316813933 16768840
11 Intron between exons 2 and 3 rs317184242 16768644
12 Intron between exons 2 and 3 rs312607775 16768620
13 Intron between exons 2 and 3 rs316637108 16768590
14 Intron between exons 2 and 3 rs314280740 16768519
15 Intron between exons 2 and 3 rs313466490 16768487
16 Intron between exons 2 and 3 rs16472277 16768480
17 Intron between exons 2 and 3 rs16472276 16768459
18 Intron between exons 2 and 3 rs16472275 16768449
19 Exon3, synonymous substitution rs16472273 16768243
20 Intron between exons 3 and 4 rs740812406 16767689
21 Intron between exons 3 and 4 rs318222659 16767644
22 Intron between exons 3 and 4 NR (LC061135, g.169 C > T) 16767626
23 Intron between exons 3 and 4 rs736122139 16767615
24 Intron between exons 3 and 4 rs734502299 16767573
25 Intron between exons 3 and 4 rs16472268 16767528
26 Intron between exons 3 and 4 rs312267702 16767513
27 Intron between exons 3 and 4 rs16472267 16767500
28 Intron between exons 4 and 5 rs314115979 16767293
29 Intron between exons 4 and 5 rs734153233 16767188
30 Intron between exons 4 and 5 rs316098909 16766910
31 Intron between exons 5 and 6 rs16472263 16766660
32 Intron between exons 5 and 6 rs16472262 16766645
33 Intron between exons 5 and 6 rs16472241 16766105
34 Intron between exons 5 and 6 rs315789178 16766076
35 Intron between exons 5 and 6 rs312905121 16766070
36 Intron between exons 5 and 6 NR (LC061137, g.79 A > T) 16766033
37 Intron between exons 5 and 6 rs314740868 16765937
38 Intron between exons 5 and 6 NR (LC061137, g.459 C > T) 16765653
39 Intron between exons 7 and 8 rs316317531 16765623
40 Intron between exons 7 and 8 rs314512343 16765596
41 Intron between exons 7 and 8 rs315716526 16765575
42 Intron between exons 7 and 8 rs314580393 16765553
43 Intron between exons 7 and 8 rs316698751 16765379
44 Intron between exons 7 and 8 rs313988812 16765084
45 Intron between exons 7 and 8 rs315678178 16765004
46 Intron between exons 7 and 8 rs313458459 16764983
47 Intron between exons 7 and 8 rs741298367 16764943
48 Exon8, synonymous substitution rs736455876 16764941
49 Exon8, synonymous substitution rs734538614 16764932
50 Exon8, synonymous substitution rs740633346 16764847
51 Intron between exons 8 and 9 rs313383381 16764846
52 Intron between exons 8 and 9 rs734385913 16764836
53 Intron between exons 8 and 9 NR (LC061138, g.563 A > C) 16764605
54 Intron between exons 8 and 9 rs314576839 16764468
55 Exon9, synonymous substitution rs318122562 16764416
56 Intron between exons 9 and 10 rs313188516 16764399
57 Intron between exons 9 and 10 rs313138210 16764386
58 Intron between exons 9 and 10 rs317616317 16763711
59 Intron between exons 10 and 11 rs730997463 16763703
60 Intron between exons 10 and 11 rs734399599 16763695
61 Intron between exons 10 and 11 rs313846569 16763655
62 Intron between exons 10 and 11 rs741458532 16763653
63 Intron between exons 10 and 11 rs736622224 16763636
64 Intron between exons 10 and 11 NR (LC061141, g.283 G > T) 16763589
65 Intron between exons 10 and 11 rs316671622 16763509
66 Intron between exons 10 and 11 rs312786975 16763416
67 Intron between exons 10 and 11 rs315852578 16763401
68 Intron between exons 11 and 12 rs314477937 16763001
69 Intron between exons 11 and 12 rs314676526 16762972
70 3′ UTR rs735594367 16762693
71 3′ UTR rs316625828 16762520

Table 2: SNPs in chicken fatty acid desaturase 1 (FADS1).

No. location and characteristics SNP_ID (accession numbers in DDBJ) Base position in chicken chromosome 5
1 5′ upstream NR1 (LC060926, g.25 A > G) 16777160
2 Exon 1, synonymous substitution rs10722582 16777539
3 Intron between exons 1 and 2 NR (LC060926, g.521 C > G) 16777656
4 Intron between exons 1 and 2 rs315346254 16780804
5 Intron between exons 1 and 2 rs733308658 16780921
6 Intron between exons 1 and 2 rs736789598 16780923
7 Intron between exons 1 and 2 rs740152791 16780924
8 Intron between exons 2 and 3 rs314358722 16781127
9 Intron between exons 2 and 3 rs15673187 16781129
10 Intron between exons 2 and 3 rs312643892 16781260
11 Intron between exons 2 and 3 rs735043547 16781832
12 Intron between exons 2 and 3 rs312319790 16781849
13 Exon 3, synonymous substitution rs732319615 16782027
14 Intron between exons 3 and 4 rs16472308 16782103
15 Intron between exons 3 and 4 rs317747268 16782118
16 Intron between exons 3 and 4 rs733216524 16782166
17 Intron between exons 3 and 4 rs313324908 16782214
18 Intron between exons 3 and 4 rs316303425 16782233
19 Intron between exons 3 and 4 rs317328157 16782238
20 Intron between exons 3 and 4 rs738216895 16782243
21 Intron between exons 4 and 5 rs736383930 16782968
22 Intron between exons 4 and 5 rs16472310 16783011
23 Intron between exons 5 and 6 rs312510513 16785052
24 Intron between exons 5 and 6 rs312795090 16785069
25 Intron between exons 5 and 6 rs314644465 16785075
26 Intron between exons 5 and 6 rs317565335 16785130
27 Exon 7, synonymous substitution rs317214584 16785758
28 Intron between exons 8 and 9 rs315961674 16786173
29 Intron between exons 8 and 9 rs313217440 16788575
30 Intron between exons 8 and 9 rs315529969 16788585
31 Intron between exons 9 and 10 rs317944267 16788628
32 Intron between exons 9 and 10 rs741640292 16788894
33 Intron between exons 9 and 10 rs734093311 16788947
34 Intron between exons 9 and 10 rs738755803 16789009
35 Intron between exons 9 and 10 rs15673219 16789863
36 Intron between exons 10 and 11 rs15673221 16789989
37 Intron between exons 10 and 11 rs314090105 16791017
38 Intron between exons 10 and 11 rs316938331 16791028
39 Intron between exons 10 and 11 rs312449387 16791061
40 Intron between exons 10 and 11 rs737848558 16791075
41 Intron between exons 10 and 11 rs315447773 16791162
42 Exon 11, synonymous substitution rs317337151 16791219
43 Exon 11, synonymous substitution rs10727332 16791234
44 Intron between exons 11 and 12 rs312748222 16792072
45 3′ downstream rs15673236 16792140
46 3′ downstream rs314733839 16792222

Table 3: SNPs in chicken fatty acid desaturase 2 (FADS2).

fisheries-livestock-production-disequilibrium

Figure 2: Linkage disequilibrium (LD) plot of fatty acid desaturase 1 (FADS1) SNPs. Red squares show the high correlation coefficients (R2) between two SNPs.

fisheries-livestock-production-desaturase

Figure 3: Linkage disequilibrium (LD) plot of fatty acid desaturase 1 (FADS1) SNPs. Red squares show the high correlation coefficients (R2) between two SNPs. Red squares show the high correlation coefficients (R2) between 2 SNPs. One big LD block was identified from the 5′-upstream regulatory region to intron between exon 2 and 3 shown on the left side.

Of the SNPs in the FADS1 gene, we selected rs733003230 (A > G) as a candidate SNP for testing associations between its type and fatty acid profile of Hinai-jidori chicken meat, since it is located at exon 1 and the distribution of alleles at the SNP sites is possibly uneven between Hinai-jidori founder (Hinai-dori and Rhode Island Red) and White Plymouth Rock breeds (Table 4). Meanwhile, of the SNPs in the FADS2 gene, we selected LC060926 (g.25 A > G) as a candidate SNP, since it was found in the 5′-upstream regulatory region within one large LD block and its SNP distribution indicates possible breed differentiation (Table 4). Therefore, a mismatch amplification mutation assay (MAMA) PCR protocol was developed that detects the rs73300323015 and LC060926 SNPs described by Cha et al. [17]. We designed PCR primers to distinguish the SNPs of FADS1 and FADS2, and PCR and genotyping were performed as described in Table 5.

Gene Fatty acid desaturase 1 (FADS1) Fatty acid desaturase 2 (FADS2)
SNP rs733003230 (A/G) LC060926 ï¼?g.25 A > Gï¼?
Locus Exon 1, synonymous 5′-upstream regulatory region
Sample    
Hinai-dori breed 1 A/A A/A
Hinai-dori breed 2 A/G A/A
Hinai-dori breed 3 A/A A/A
Rhode Island Red breed 1 G/G A/A
Rhode Island Red breed 2 A/G A/A
Rhode Island Red breed 3 G/G A/G
White Plymouth Rock breed 1 A/A G/G
White Plymouth Rock breed 2 A/A A/G
White Plymouth Rock breed 3 A/A G/G

Table 4: Genotypes of selected SNPs in the sequenced individuals.

  Primers (5′ → 3′) Product (bp) SNP
A G
FADS1-A ccggcgtagtggctgatgac 195 +
  ggCggggagagccatgCaA      
FADS1-G ccggcgtagtggctgatgac 195 +
  ggAggggagagccatgTaG      
FADS2-A tcgcacatagctccgtGtT 274 +
  aaatcctgccgcagagaag      
FADS2-G aaccttccgctctatcacca 397 +
ã?? tgggccgagcttgccGcG ã?? ã?? ã??

Table 5: The primers and target position in chicken fatty acid desaturase 1 and 2 (FADS1 and FADS2) genes for the mismatch amplification mutation assay.

As shown in the Table 5, Bases shown in lower case with a capital represent induced mismatches. Bases shown in lower case at the 3′- end represent target single nucleotide polymorphisms (SNPs). The SNP that can or cannot be amplified by PCR for each primer set are shown as ‘+’ or ‘–’, respectively. For the PCRs of FADS1-A and FADS2-G, we used 10-μL reaction volumes containing the following: 2 pmol of each primer for each marker, 200 μM of each dNTP, 0.5 units of Paq5000DNA Polymerase (Agilent Technologies, La Jolla, CA, USA), 1× reaction buffer (containing 2 mM MgCl2) provided by the manufacturer, and 10 ng genomic DNA. Reactions were performed in a 96-well plate in a thermal cycler (GeneAmp System 9700; Perkin- Elmer, Foster City, CA, USA) using the following conditions: initial denaturation at 95°C for 2 min; and 35 cycles at 95°C for 20 s, at 67°C for 30 s, at 72°C for 30 s (FADS1-A), or 35 cycles at 95°C for 20 s, at 57.5°C for 30 s, at 72°C for 30 s (FADS2-G). For the PCRs of FADS2-A, we used 10-μL reaction volumes containing the following: 2 pmol of each primer, 200 μM of each dNTP, 0.5 units of KOD plus polymerase (TOYOBO, Tokyo, Japan), 1 × reaction buffer provided by the manufacturer, 1 mM MgSO4, and 10 ng genomic DNA. Reactions were performed in a 96-well plate in the thermal cycler using the following conditions: initial denaturation at 94°C for 2 min; and 35 cycles at 94°C for 20 s, at 60°C for 30 s, at 72°C for 30 s. For the PCRs of FADS1-G, PCR amplification was performed in an 8-μL reaction volumes containing the following 2 pmol of each primer, and 4 μL of 2 × PCR mix (EmeraldAmp; Takara, Otsu, Japan), and 10 ng genomic DNA. Reactions were performed in the thermal cycler (GeneAmp System 9700; Perkin-Elmer, Foster City, CA, USA) using the following conditions: 30 cycles of 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s. The PCR products were electrophoresed on a 2.0% agarose gel with 1 × Tris-acetate EDTA (TAE) buffer and stained with ethidium bromide. The combination of these results enabled us to identify the genotype of each individual.

Estimates of association for SNPs in FADS1 (rs73300323015) and FADS2 (LC060926) with fatty acid composition in the thigh meat are shown in Table 6. In both FADS1 and FADS2, the ARA and DHA compositions were significantly higher in the G than in the A allele. In FADS1, stearic acid (SA, C18:0) and LA compositions were significantly higher in the G than in the A allele. Meanwhile, myristic (MA, C14:0), palmitic (PA, C16:0), and palmitoleic (POA, C16:1) acid compositions were significantly lower in the G than in the A allele. There were no significant differences between the A and G alleles in the other fatty acid compositions in either FADS1 or FADS2 TABLE 5.

Gene Fatty acid desaturase 1 (FADS1)ã?? Fatty acid desaturase 2 (FADS2)ã??
Locus rs733003230 (A > G) LC060926 ï¼?g.25 A > Gï¼?
SNP type A G A G
SNP Frequency 0.453 0.547 0.813 0.188
Fatty acid % of total analyzed fatty acid    
Myristic acid (C14:0) 0.35 ± 0.01 0.32 ± 0.01** 0.34 ± 0.00 0.31 ± 0.01
Palmitic acid (C16:0) 12.02 ± 0.27 11.02 ± 0.16** 11.64 ± 0.11 10.78 ± 0.46
Palmitoleic acid (C16:1) 2.36 ± 0.28 1.71 ± 0.13* 2.11 ± 0.10 1.56 ± 0.30
Heptadecanoic acid (C17:0) 0.07 ± 0.02 0.09 ± 0.01 0.08 ± 0.01 0.09 ± 0.02
 Stearic acid (C18:0) 3.65 ± 0.22 4.09 ± 0.09* 3.80 ± 0.12 4.29 ± 0.30
 Oleic acid (C18:1) 19.58 ± 0.58 18.71 ± 0.35 19.24 ± 0.26 18.52 ± 0.75
 Linoleic acid (C18:2n-6) 9.33 ± 0.68 11.07 ± 0.36* 10.07 ± 0.30 11.21 ± 0.98
 γ-Linolenic acid (C18:3n-6) 0.07 ± 0.02 0.05 ± 0.01 0.07 ± 0.01 0.04 ± 0.03
 α-Linolenic acid (C18:3n-3) 0.32 ± 0.02 0.34 ± 0.01 0.33 ± 0.01 0.35 ± 0.03
Eicosenoic acid (C20:1) 0.14 ± 0.02 0.13 ± 0.01 0.13 ± 0.01 0.14 ± 0.02
Eicosadienoic acid (C20:2) 0.09 ± 0.03 0.05 ± 0.01 0.08 ± 0.01 0.05 ± 0.03
Eicosatrienoic acid (C20:3(n-3+n-6)) 0.10 ± 0.03 0.06 ± 0.01 0.08 ± 0.01 0.03 ± 0.03
Arachidonic acid (C20:4n-6) 1.01 ± 0.15 1.33 ± 0.07* 1.10 ± 0.07 1.55 ± 0.19*
Lignoceric acid (C24:0) 0.09 ± 0.03 0.09 ± 0.01 0.09 ± 0.01 0.09 ± 0.03
Docosahexaenoic acid (C22:6n-3) 0.25 ± 0.04 0.35 ± 0.02* 0.28 ± 0.02 0.40 ± 0.06*
 Unidentified FA 0.56 ± 0.05 0.57 ± 0.03 0.56 ± 0.02 0.60 ± 0.07

Table 6: SNP effects of chicken fatty acid desaturase 1 and 2 (FADS1 and FADS2) on fatty acid profiles of Hinai-jidori thigh meat.

The association of FADS1 and FADS2 haplotypes with fatty acid compositions is shown in Table 7. The ARA and DHA compositions of the G-G-haplotype were significantly higher than those of the A-Ahaplotype. The LA composition of the A-A-haplotype was lower than that of G-A haplotype. The POA composition of the A-A-haplotype was higher than that of the G-A haplotype. The MA and PA compositions of the A-A-haplotype were higher than those of the G-A- and G-Ghaplotypes, respectively. There were no significant differences among the haplotypes with respect to other fatty acid compositions.

Combined haplotypes of FADS1 and FADS2 A-A G-A G-G
Frequencies of plausible haplotypes under linkage equilibrium 0.453 0.359 0.188
Fatty acid % of total analyzed fatty acid      
Myristic acid (C14:0) 0.35 ± 0.01a 0.33 ± 0.01b 0.31 ± 0.01b
Palmitic acid (C16:0) 12.04 ± 0.15a 11.14 ± 0.28b 10.75 ± 0.35b
Palmitoleic acid (C16:1) 2.38 ± 0.22a 1.78 ± 0.30b 1.54 ± 0.46ab
Heptadecanoic acid (C17:0) 0.07 ± 0.01 0.09 ± 0.02 0.10 ± 0.03
 Stearic acid (C18:0) 3.63 ± 0.17 4.00 ± 0.22 4.30 ± 0.32
 Oleic acid (C18:1) 19.60 ± 0.36 18.80 ± 0.58 18.49 ± 0.86
 Linoleic acid (C18:2) 9.31 ± 0.49b 10.99 ± 0.69a 11.26 ± 1.05ab
 γ-Linolenic acid (C18:3n-6) 0.08 ± 0.01 0.05 ± 0.02 0.03 ± 0.03
 α-Linolenic acid (C18:3n-3) 0.32 ± 0.02 0.34 ± 0.03 0.35 ± 0.04
Eicosenoic acid (C20:1) 0.14 ± 0.01 0.13 ± 0.02 0.14 ± 0.02
Eicosadienoic acid (C20:2) 0.09 ± 0.02 0.06 ± 0.03 0.05 ± 0.03
Eicosatrienoic acid (C20:3(n-3+n-6)) 0.10 ± 0.02 0.07 ± 0.03 0.03 ± 0.03
Arachidonic acid (C20:4n-6) 0.99 ± 0.12b 1.24 ± 0.15ab 1.56 ± 0.24a
Lignoceric acid (C24:0) 0.09 ± 0.02 0.09 ± 0.03 0.09 ± 0.04
Docosahexaenoic acid (C22:6n-3) 0.25 ± 0.04b 0.32 ± 0.04ab 0.40 ± 0.07a
 Unidentified FA 0.56 ± 0.03 0.56 ± 0.06 0.60 ± 0.07

Table 7: Haplotype effects of chicken fatty acid desaturase 1 and 2 (FADS1 and FADS2) on fatty acid profiles of Hinai-jidori thigh meat.

Discussion

To date, most research concerning FADS1 and FADS2 has focused on humans. For example, Tanaka et al. [18] reported that an SNP near FADS1 was significantly associated with the plasma concentrations of ARA, eicosapentaenoic acid (EPA, C20:5n-3), and eicosadienoic acid (EDA, C20:2n-6) in a human population (InCHIANTI) living in the Chianti region of Tuscany, Italy. Schaeffer et al. [19] reported that polymorphisms of the FADS1 and FADS2 gene cluster showed significant associations with the level of the n-6 fatty acids, LA, GLA, EDA, DGLA, ARA, dodecylthioacetic acid (DTA, C22:4 n-6), and n-3 fatty acids, ALA, EPA, and docosapentaenoic acid (DPA, C22:5n-3) in serum phospholipids. Moltó-Puigmartí et al. [20] reported that polymorphisms of the FADS1 and FADS2 gene cluster showed significant associations with the level of the n-6 fatty acids, LA, GLA, ARA, DGLA, DTA, and n-3 fatty acid, DHA, in serum phospholipids, whereas the gene cluster showed significant associations with the level of the n-6 fatty acids, DGLA, ARA, DTA, and n-3 fatty acids, EPA, DPA and DHA, in human milk. Together, these data suggest that the FADS1 and FADS2 gene cluster affect not only n-6 but also n-3 fatty acids, especially LA, ARA, and DHA in humans.

In poultry, associations between genetic variants of the FADS2 gene and fatty acid profile in Japanese quail eggs and chicken meat have been reported; however, no studies on the associations between the genetic variants of the FADS1 and FADS2 gene clusters and fatty acid profiles in meat have been reported. Khang et al. [21] reported that an SNP of FADS2 showed significant associations with the level of the n-6 fatty acids LA and ARA and the n-3 fatty acid DHA in egg yolk using Japanese quail lines selected for high and low n-6/n-3 polyunsaturated fatty acid (PUFA) ratios. Zhu et al. [22] reported that two SNPs of FADS2 showed significant associations with the level of the n-6 fatty acids, LA and ARA, in the muscle of an F2 resource population crossing a Chinese indigenous breed and broiler chickens, although the meat portion sampled was not documented. In the present study, we found that polymorphisms of the FADS1 and FASD2 genes, and FADS1 and FADS2 gene clusters affected the fatty acid profile, i.e., ARA and DHA in the thigh meat in Hinai-jidori chickens. Since chickens with higher ARA contents are tastier than those with lower ARA contents [6], the data in the present study suggested that a breeding strategy for improving the taste of Hinai-jidori meat could be developed using SNPs of FADS1 and FASD2 as selection markers. However, further studies are needed to determine whether the SNP effect is applicable to the other chicken strains and if similar effects are observed in chicken eggs.

Rikimaru and Takahashi [2] reported that the ARA and DHA compositions of Hinai-jidori chickens at the age of 22 wk were significantly higher than those of broiler chickens at the age of 8 and 22 wk. Sirri et al. [23] compared fatty acid profiles of breast and thigh meat among fast- (Cobb 700), medium- (Naked neck Kabir), and slow- (Brown Classic Lohman) growing strain chickens slaughtered at the age of 81 d. The SA, ARA and DHA compositions of the slow-growing strain were significantly higher than those of the fast- and mediumgrowing strains, whereas the MA, POA, and oleic acid (OA, C18:1) compositions of the slow-growing line were significantly lower than those of the fast- and medium-growing lines both in breast and thigh meat. Jayasena et al. [24] reported that Korean native chickens at the age of 100 d showed significantly higher compositions of LA, ARA, and DHA than broilers at the age of 32 d. Boschetti et al. [25] reported that medium-growing (Kabir Red) and particularly slow-growing (Hyline W36) lines showed a greater expression of the FADS1 and FADS2 genes in hepatic tissue than a fast-growing line (Cobb 500) at 81 d of age, although they did not speculate associations between FADS1 and FADS2 gene polymorphisms and fatty acid profiles in the meat. These reports may suggest that there is a significant strain difference in the fatty acid profile of meat; however, we would like to refer to sex differences of samples in these reports. Rikimaru and Takahashi [2] used Hinai-jidori females because almost 100% of the Hinai-jidori chickens sold commercially are females, whereas Sirri et al. [23], Jayasena et al. [24], and Boschetti et al. [25] used males. In fact, Sirri et al. [26] reported that the ARA, DPA, and DHA composition of breast and thigh meat of cocks were significantly higher than those of capons at the age of 180 d. To explain the difference between cocks and capons, the authors supposed that D6D activity is affected by testosterone, since Clejan et al. [27] found a decrease of ARA and DHA in castrated rats owing to the lack of testosterone and showed that the administration of testosterone to castrated rats could bring the ARA content to normal values. It is known that testosterone exists in plasma before the onset of puberty in cockerels [28-30]. Together, the difference of fatty acid profiles detected among Cobb 700, Naked neck Kabir, and Brown Classic Lohman at 81 d of age [23], and between 100-d-old Korean native chickens and 32-d-old broilers [24] may simply reflect the plasma testosterone concentration of each strain at slaughter age, although this information is unknown. Meanwhile, this study has some advantages over previous studies in assessing the effect of the FADS1 and FADS2 genes on the fatty acid profiles of the meat. In particular, the effects of testosterone on fatty acid profiles and environmental factors are negligible, since we used female chickens that hatched on the same day and were reared under identical environmental conditions for the same duration.

Conclusion

In conclusion, this is the first report to show the possibility of using polymorphisms of the FADS1 and FASD2 gene, and FADS1 and FADS2 gene clusters as selection markers for Hinai-Jidori chickens to improve fatty acid profiles, especially ARA and DHA. Moreover, this report provides an additional line of evidence that FADS1 and FADS2 polymorphisms affect fatty acid profiles in vertebrates.

Acknowledgment

We thank the staff of the Akita Prefectural Livestock Experiment Station (Daisen, Japan) for their kind assistance.

References

--
Post your comment

Share This Article

Article Tools

Article Usage

  • Total views: 5001
  • [From(publication date):
    December-2016 - May 23, 2026]
  • Breakdown by view type
  • HTML page views : 3920
  • PDF downloads : 1081
International Conferences 2026-27
 
Meet Inspiring Speakers and Experts at our 3000+ Global

Conferences by Country

Medical & Clinical Conferences

Conferences By Subject

Top Connection closed successfully.