中国P站

ISSN: 2332-0877
Journal of Infectious Diseases & Therapy
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on Medical, Pharma, Engineering, Science, Technology and Business

Detection of Chikungunya virus (CHIKV) in urine of infected mice: a Potential Non-invasive Diagnostic Tool for CHIKV

Jones PH1 and Okeoma CM1,2*
1Department of Microbiology, Carver College of Medicine, University of Iowa, Iowa City, IA, USA
2Interdisciplinary Graduate program in Molecular and Cellular Biology (MCB), University of Iowa, Iowa City, IA, USA
Corresponding Author : Chioma M Okeoma
Department of Microbiology
Carver College of Medicine
University of Iowa, Iowa City, USA
Tel: 319-335-7906
E-mail: chioma_okeoma@uiowa.edu
Received: June 03, 2015 Accepted: August 01, 2015 Published: August 08, 2015
Citation: Jones PH and Okeoma CM (2015) Detection of Chikungunya virus (CHIKV) in urine of infected mice: a Potential Non-invasive Diagnostic Tool for CHIKV. J Infect Dis Ther 3:226. doi:10.4172/2332-0877.1000226
Copyright: © 2015 Jones et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Related article at ,

Visit for more related articles at Journal of Infectious Diseases & Therapy

Abstract

Background: The reemergence of Chikungunya virus (CHIKV) infection and the spread of the virus throughout the world call for a fast, reliable, and improved laboratory diagnostic procedures. The aim of this study was to determine if CHIKV genome is present in other body fluids besides plasma as a tool for developing non-invasive diagnostic method.
Methods: This study utilized a sensitive and less invasive assay that combines the specificity of immunocomplexing and the sensitivity of real-time PCR to detect CHIKV in urine and plasma of infected mice.
Results: CHIKV RNA was detected by immuno-capture-quantitative reverse transcriptase PCR (IC-qPCR) in urine and plasma of infected mice. Viral RNA was detected in urine up to day 30, long after viral clearance in plasma. Furthermore, infectious CHIKV was detected in urine by cell-based immunofluorescence and 50% tissue culture infective dose (TCID50) assays, suggesting the presence of infectious virus in urine.
Conclusion: We demonstrate a potential non-invasive that could be adapted to screen forCHIKV infection in viremic and aviremic patients using urine.

Keywords

Chikungunya; CHIKV; Urine; Plasma; Immuno-capture PCR
Introduction

Chikungunya virus (CHIKV) infections predominantly occur in tropical and subtropical areas of the world. However, in 2013, CHIKV was reported in the Americas, including 2014 report of local transmission in the United States. At the time of writing this manuscript in December of 2014, the number of traveler-associated CHIKV cases in US states and territories stand at 1,911 cases from US, 32 in Puerto Rico, and 6 in US Virgin Islands. The number of locally-transmitted cases stands at 11 from the state of Florida (US), 3,402 in Puerto Rico, and 86 in US Virgin Islands, ().

With the rapid and continued spread of CHIKV outside and within the US, it is imperative to understand the pathogenesis of CHIKV and to develop a reliable non-invasive method of detection and/or diagnosis of CHIKV. Infection with CHIKV results in a spectrum of clinical symptoms, such as fever, encephalitis, neuropathy, and myelopathy [1-3]. Urine retention and paraparesis have also been associated with CHIKV infection [3]. Compared to healthy controls, CHIKV-infected patients were shown to have high levels of proline, hydroxyproline, and mucopolysaccharides in their urine [4].

Most but not all sites of CHIKV replication and CHIKV-associated disease have been identified [5-10]. Infection with CHIKV is presumed to cause encephalitis, myelopathy and neuropathy and patients infected with CHIKV present with [1-3]. However, it is unknown whether the urinary tract organs and tissues such as kidney and bladder are infected with CHIKV. This current research was conducted to assess whether CHIKV infects urinary tract organs and tissues and if CHIKV could be detected in the urine of infected hosts.
Materials and Methods

Virus stock and virus propagation

CHIKV strain 181/25 [5] was inoculated onto Vero cells. Upon appearance of cytopathic effects, culture supernatants were harvested, clarified (1,000 × g for 5 min), aliquoted, and stored (-80°C) until titres were determined by end point dilution assay on Vero cells.
Animals and cells

5-week old female C57BL/6 mice were purchased from NCI – Frederick National Laboratory and maintained at the University of Iowa vivarium. Mice were inoculated on the hind footpad with CHIKV 181/25 (1.5 × 107 PFU) as previously described [6] and according to protocol approved by the University of Iowa Animal Care and Use Committee (IACUC). Vero cells were from the American Type Culture Collection (ATCC)]. Cells were maintained in Dulbecco’s modified Eagle’s medium as recommended by the ATCC.
Antibodies

Mouse anti-CHIKV was obtained from the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA) through Dr. Robert Tesh of the University of Texas Medical Branch (UTMB) Galveston, Texas. Alexa fluor goat anti-mouse secondary antibody was from Life Technology.
Sample collection

Matched specimens (plasma, urine, kidney, and bladder) were collected from infected mice. Matched longitudinal plasma and urine samples were collected and evaluated. Following collection, samples were processed and stored at -80°C until required for analysis.
Detection of infectious CHIKV

Serial dilutions of infectious fluids were inoculated onto replicate Vero cells using a previously published protocol [6]. Cells were examined for cytopathicity and the end point (day 5 for our assays) was calculated from the data and expressed as 50% tissue culture infective dose (TCID50). Alternatively, infectious virus was determined by confocal microscopy of Vero cells plated on cover slips.
RNA isolation, viral and host gene mRNA quantification

Total RNA was isolated from infected specimens using RNeasy mini kit (Qiagen). Equivalent amounts of DNase I (Qiagen) treated RNA were reverse-transcribed with high capacity cDNA reverse transcription Kit (ABI). Target specific primers including CHIKV nsP1 and E1 sequences were amplified using 7500 fast real-time PCR machine (ABI) as previously described [8-13].
Immuno-capture and Viral RNA quantification by PCR

200 µl of anti-CHIKV antibody diluted 1:100 in 50 mM NaCO3 (pH 9.6) was added into 0.2 ml thin-wall tubes (TempAssure PCR 8-tube strips with caps, USA Scientific) and incubated for 4 h at 37°C. The tubes were emptied and replaced with 1% bovine serum albumin in 50 mM NaCO3 (pH 9.6) to block unspecific binding. Tubes were incubated at 37°C for 1 h followed by thorough washing (three times) with buffer containing PBS, 0.05% Tween, and 0.02% sodium azide. After washing, 2 µl of clarified urine or plasma that are free of cellular debris were diluted in PBS to a total volume of 200 µl. Diluted samples were added to the tubes and incubated at 4°C overnight. Tubes were thoroughly washed (six times) with buffer containing 50 mM KCl, 10 mM Tris (pH 9), and 1.2 mM MgCl2 • 6H2O. Captured virions were incubated in a buffer containing 50 mM KCl, 10 mM Tris (pH 9), 1.2 mM MgCl2 • 6H2O, and 0.1% Triton X-100 for 5 minutes at room temperature. Triton X-100 was used to directly lyse the virus circumventing the need for RNA extraction. The immunocomplex was used for cDNA synthesis by the addition of cDNA synthesis reagents (high-capacity cDNA kit, Applied Biosystems) followed by PCR detection of relative CHIKV E1 expression by real-time PCR. The following primers were used: E1F: GCATCAGCTAAGCTCCGGGTC and E1R: CAATGTCTTCAGCCTGGACACC [14].
Statistics

Statistical analysis was performed by paired Student's t-test, and data presented as mean ± standard deviation (SD). Error bars represent standard deviations and significance was taken at P<0.05* or <0.01**.
Results

CHIKV infects bladder and kidney

To determine whether the kidney and/or bladder are susceptible to CHIKV, we collected the kidneys and bladders from 5-week old female C57BL/6 mice that were infected with live-attenuated CHIKV 181/25. To assess the extent of CHIKV gene expression in kidney and bladder, we extrapolated E1 (Figure 1A) and nsP1 (Figure 1B) abundance from standard curves generated from dilution series of E1 or nsP1 amplified from CHIKV infected Vero cells. CHIKV gene expression values were normalized to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) that was used as an endogenous control to correct for sample to sample variations [6]. Although variability exists among infected mice tissues, more CHIKV RNA was detected in the kidney compared to the bladder. Furthermore, we evaluated the level of infectious virus present in the kidney and bladder. Interestingly, both kidney and bladder produced infectious virus as revealed by TCID50 experiments (Figure 1C). These results suggest that CHIKV infects, replicates, and produces infectious virus in the kidney and bladder.
Immuno-capture-quantitative reverse transcriptase PCR (IC-qPCR) based detection of CHIKV RNA in urine samples

The mammalian bladder collects and stores urine excreted by the kidneys. Because the kidney and bladder are susceptible to CHIKV and infectious virus is present in these tissues, we queried whether CHIKV is shed in urine of infected mice.

Immuno-capture of CHIKV particles shed into urine samples of infected mice was performed with anti-CHIKV polyclonal antibody followed by PCR amplification of CHIKV E1 sequences. PCR amplicons were separated by agarose gel electrophoresis and visualized with ethidium bromide as previously described [15,16].

Results show that CHIKV genome is present in both plasma and urine of infected mice (Figure 2A). Comparative analysis of CHIKV RNA in plasma and urine by quantitative PCR reveals a significant difference between plasma and urine CHIKV RNA content (Figure 2B).
Limit of CHIKV RNA detection by Immuno-capture-quantitative reverse transcriptase PCR (IC-qPCR)

To determine the limit of CHIKV detection by IC-qPCR, we generated E1 standard curve as described in figure 1. The standard curve was used to extrapolate E1 copy numbers from a series of dilutions constructed from cell free CHIKV isolated from infected Vero cells. The limit of detectionâ茂驴陆茂驴陆defined as the minimum concentration at which IC-qPCR distinguished a positive sample from negative sample is approximately 2 copies/ µl (Figure 2C).
Comparison of CHIKV detection rates between plasma and urine samples

To further understand the differences between plasma and urine viral loads by IC-qPCR, we used autologous serial plasma and urine samples collected from infected mice. Naïve samples were used as controls. CHIKV was present in urine samples on all days tested (days 1, 3, 5, 7, 9, and 30â茂驴陆茂驴陆experimental end point) with some variability in the amount of virus detected on a given day (Figure 2D).

However, plasma samples were positive for CHIKV on days 1 to 7. By day 9, plasma viral RNA has diminished below day 1 level, while urine viral RNA peaked (Figure 2D), suggesting that viral shedding into urine may be occurring.

Although declining, viral load in urine remained high up to day 30 post infection. These results reveal that each sample type could be of use in detecting CHIKV. However, urine sample has more value as CHIKV could be detected in urine long after the virus is cleared from the blood. Therefore, detection and quantitation of urine-associated viral load by IC-qPCR may provide a reliable and non-invasive method of CHIKV detection.
Detection of infectious CHIKV in urine samples

Presence of infectious CHIKV in urine was assessed by immunofluorescent (IF) detection of CHIKV antigen and TCID50 studies. Infectious virus was detected by IF in Vero cells inoculated with plasma and urine collected from mice 24 h after infection. Cells were stained with anti-mouse CHIKV polyclonal antibody [6] and confocal images were acquired using Zeiss 510 confocal microscope. While robust CHIKV antigen was detected in Vero cells inoculated with plasma, a little above background antigen staining was present in cells inoculated with urine (Figure 3A).

Alternatively, serial dilutions of infectious fluids were inoculated onto replicate Vero cells using a previously published protocol [6]. Cells were examined for cytopathicity to quantify virus titer using endpoint dilution assay [6], and results were expressed as TCID50. About 2 × 102 CHIKV particles/ml was detected in Vero cells inoculated with plasma compared to 1 × 10-1 particles/ml present in urine-inoculated Vero cells (Figure 3B). These results indicate that while comparable levels of CHIKV genome may be present in both urine and plasma, less infectious particles reside in urine.
Discussion

Outbreaks of CHIKV infections have occurred throughout the world since its discovery in 1952. Infected persons present with acute febrile illness associated with mild to severe skin rash, joint pain (Arthritis) and muscle pain (Myalgia) that can persist long after virus clearance, resulting in high morbidity. Renal dysfunction has also been linked to CHIKV infection [3] but whether the urinary tract is susceptible to CHIKV infection is unknown.

In this study, we reveal that CHIKV infects the bladder and kidney of the host and that CHIKV RNA is present in urine of infected mice. Interestingly, infectious CHIKV was also detected in the bladder and kidney, as well as in urine samples. However, the titre of urine-associated infectious virus was significantly lower compared to plasma-associated virus from the same mice. It is not surprising that the titre of infectious CHIKV in urine is extremely low since other mosquito borne viruses such as West Nile Virus [17] and Dengue virus [18] have detectable viral genome in the absence of infectious virus in the urine of infected patients.

The occurrence of CHIKV minus strand RNA and infectious virus in urine samples is indicative of low but active viral replication in the urinary tract. Replication of CHIKV in the kidney and bladder could be the pathological mechanism for the presence of CHIKV RNA in urine. Presence of CHIKV RNA in urine beyond 7 days meant that CHIKV diagnosis could still be made even during the aviremic stage of infection.
Conclusion

Presently, it is not known whether human urinary tract organs and tissues are susceptible to CHIKV infection. This study reveals active CHIKV replication in the kidney and bladder of mice and highlights the usefulness of urine for detection of CHIKV infection long after clearance of plasma viremia. Future studies should elucidate whether human urinary tract organs and tissues are susceptible to CHIKV and evaluate the usefulness of human urine as an additional and/or alternative non-invasive laboratory diagnostic tool for CHIKV infection.
Acknowledgment

This work was supported by Funds from the Department of Microbiology of the University of Iowa. Publication of this manuscript was made possible through core services from the University of Iowa Central Microscopy Research Facility. We thank Alexander Canfield and Bryson Okeoma of University of Iowa for help with endpoint dilution assay and constructive criticisms respectively.
 


References



















--

Figures at a glance

Figure Figure Figure
Figure 1 Figure 2 Figure 3
Post your comment

Share This Article

Article Tools

Article Usage

  • Total views: 16277
  • [From(publication date):
    August-2015 - May 24, 2026]
  • Breakdown by view type
  • HTML page views : 11340
  • PDF downloads : 4937
International Conferences 2026-27
 
Meet Inspiring Speakers and Experts at our 3000+ Global

Conferences by Country

Medical & Clinical Conferences

Conferences By Subject

Top Connection closed successfully.