Downregulation of UQCRC1 Exacerbates Hypoxia-Induced Mitochondrial Damage in H9C2 Cardio Myocytes
Received: 05-Aug-2024 / Manuscript No. DPO-24-144499 / Editor assigned: 08-Aug-2024 / PreQC No. DPO-24-144499 (PQ) / Reviewed: 23-Aug-2024 / Revised: 01-Aug-2025 / Manuscript No. DPO-24-144499 (R) / Published Date: 08-Aug-2025 DOI: 10.4172/2476-2024.1000257 QI No. / DPO-24-144499
Abstract
Ubiquinol Cytochrome C Reductase Core Protein I (UQCRC1) is a vital component of mitochondrial proteins, and its aberrant expression or dysfunction may play a significant role in the onset and progression of various diseases. Our previous study demonstrated notable alterations in UQCRC1 protein levels within myocardial cells in a murine model of acute myocardial ischemia. However, there is currently a paucity of literature addressing how fluctuations in UQCRC1 protein levels influence mitochondrial function in myocardial cells.
In this investigation, we silenced the UQCRC1 gene in rat myocardial cells under hypoxic conditions using a constructed shRNA expression vector. We employed a variety of experimental methodologies, including Hoechst staining, inverted fluorescence microscopy, electron microscopy, and CCK-8 assays, to evaluate the apoptosis rate of H9C2 cells and document pathological changes in mitochondrial ultrastructure. Furthermore, we assessed cellular viability, lactate dehydrogenase levels, reactive oxygen species, ATP expression, and alterations in mitochondrial membrane potential in H9C2 cells to gain preliminary insights into the impact of the UQCRC1 gene on mitochondrial function in hypoxic rat myocardial cells from both morphological and functional perspectives.
Our findings elucidate the underlying mechanisms associated with the occurrence and prognosis of ischemic heart disease cardiomyopathy through the UQCRC1 pathway.
Keywords: UQCRC1, Hypoxia, Cardio myocytes, Mitochondria, Ischemic heart disease
Introduction
Ubiquinol Cytochrome C Reductase Core Protein 1 (UQCRC1) is a nuclear DNA-encoded protein consisting of 480 amino acids. It is a subunit of respiratory chain complex III (also known as complex bc1), primarily located in the inner mitochondrial membrane [1-2]. Its main function is to catalyze electron transfer, participate in oxidative phosphorylation (OXPHOS), and regulate energy metabolism [3-7]. In our previous study [8], we found significant changes in the UQCRC1 protein content in myocardial cells of mice with acute myocardial ischemia compared to the sham-operated group. However, the impact of low expression of UQCRC1 protein on mitochondrial function in myocardial cells, as an important mitochondrial-related protein, has not been reported by anyone.
Mitochondria are the main sites of cellular energy supply and metabolism, involved in regulating processes such as cellular energy conversion, apoptosis, and oxidative stress, closely related to maintaining normal cell functions [9]. Mitochondria have their own genome, known as mtDNA. The mtDNA contains 37 genes and exhibits a certain degree of independence in terms of genomic and replication timescale, encoding respiratory chain complexes I, III, IV, and Adenosine Triphosphate (ATP) synthase complex V subunits, together with ribosomal RNA (rRNAs) and transfer RNA (tRNAs). The respiratory complexes are central to cellular oxidative phosphorylation, where electron transfer is coupled with ATP production, resulting in the byproduct Reactive Oxygen Species (ROS). The mitochondrial/free radical theory suggests that the generation of ROS causes mtDNA damage and respiratory chain dysfunction, which further promotes ROS production, creating a vicious cycle. Additionally, mitochondria store electrochemical potential in the mitochondrial inner membrane while producing ATP. If the distribution of protons and other ions on both sides of the mitochondrial membrane is uneven, a membrane potential (Mitochondrial Membrane Potential, MMP) is formed. The stability of MMP plays a crucial role in maintaining normal cellular physiological function, serving as a sensitive indicator of cellular damage. A decrease or disappearance of MMP is an early event in cellular apoptosis. Studies have shown that a decrease in MMP leads to mitochondrial swelling and outer membrane rupture, ultimately leading to the release of cytochrome C, activating caspase proteases and causing cell apoptosis. Cell apoptosis damages the cell membrane, and the high intracellular enzyme Lactate Dehydrogenase (LDH) leaks into the extracellular fluid, resulting in an elevated LDH release rate. LDH is one of the intracellular enzymes of live cells, and when the cell membrane is severely damaged, LDH in the cytoplasm will be released into the culture medium, leading to a significant increase in LDH enzyme activity in the culture medium. The level of LDH released reflects the degree of cell membrane damage, with changes in release rate indicating alterations in cell membrane permeability. An increase in LDH activity is an important marker of cell damage.
This study developed a shRNA expression vector to downregulate UQCRC1 gene expression. The transfection efficiency in H9C2 cardio myocytes was evaluated using fluorescence microscopy. Following transfection, UQCRC1 expression levels in the H9C2 cells were quantified through RT-qPCR and Western blot analyses. Under hypoxic conditions, the study examined the effects of reduced UQCRC1 expression on H9C2 cell apoptosis and mitochondrial ultrastructure. Additionally, fluctuations in ATP, Reactive Oxygen Species (ROS), Mitochondrial Membrane Potential (MMP), and Lactate Dehydrogenase (LDH) levels were measured, providing an initial investigation into how diminished UQCRC1 expression influences the mitochondrial structure and function of hypoxic H9C2 myocardial cells.
Materials and Methods
Reagents and instruments
Rat cardiac myocytes (H9C2 cells) were obtained from the Cell Bank of the Chinese Academy of Sciences in Shanghai. The UQCRC1-RNAi construct and its corresponding control empty vector were purchased from Shanghai Jikai Gene. Lipofectamine™ 3000 Reagent was sourced from Invitrogen. Sugar-free DMEM medium and fetal bovine serum were acquired from Gibco, while high-glucose DMEM medium and Qinglian Shuang anti-toxin were obtained from BI Company.
For protein analysis, we used a total protein extraction kit, BCA protein content detection kit, and SDS-PAGE rapid gel preparation kit, all purchased from Kaiji Biology Company. The UQCRC1 mouse monoclonal antibody (Ab110252) was obtained from Abcam (USA), and the GAPDH rabbit polyclonal antibody (bs-2188R) was sourced from Boson (China). Horseradish peroxidase-labeled goat anti-rabbit IgG (ZB-2301) and horseradish peroxidase-labeled goat anti-mouse IgG (ZB-2305) were acquired from ZsBio (China). Hoechst 33342 dye was purchased from Solarbio, while the CCK-8 cell proliferation/ toxicity detection kit (KGA317) came from KGI Biotechnology Company (China). The lactate dehydrogenase cytotoxicity detection kit (LDH, C0017), mitochondrial membrane potential detection kit (TMRE, C2001S), and ROS reactive oxygen species detection kit (R6033) were all obtained from Biyun Tian Biotechnology Company (China). The enhanced ATP detection kit (S0027) was also sourced from Biyun Tian Biotechnology Company.
For equipment, a tri-gas cell incubator (Steri-Cycle i250) was acquired from ThermoFisher (USA), and an inverted fluorescence microscope (IX73) was purchased from Olympus (Japan). An enzyme-linked immunosorbent assay system (ABI 7500) and a fluorescence microplate reader (Feyond-A300) were both obtained from ThermoFisher (USA) and Ausun (Hangzhou, China), respectively. The gel chemiluminescence imaging system was purchased from Shanghai Qinxiang (China), and a transmission electron microscope (HT-7800) was sourced from Hitachi Corporation (Japan). Cell culture consumables were acquired from Corning Corporation.
Design of shRNA
The shRNA construct comprises three encoding clones specifically designed to target the rat NM_001004250 transcripts. The target sequences are as follows:
RNAi 1: GCGCCCATCTTAATGCCTACA;
RNAi 2: GCACAGACTTGACTGACTACC;
RNAi 3: GCTTCCGTTGCTGTAGCTAAC.
Single-stranded primers were synthesized based on these interference sequences, which were then annealed to form doublestranded DNA. This double-stranded DNA was subsequently ligated into linearized vectors. The ligation products were transformed into competent cells, followed by PCR identification and sequencing of positive clone colonies. The plasmids and empty vectors utilized in this study were synthesized and provided by Shanghai Jikai Gene Chemical Technology Co., Ltd.
Cell culture
H9C2 cells were cultured in DMEM (Dulbecco’s Modified Eagle Medium) supplemented with 10% Fetal Bovine Serum (FBS) and 1% Penicillin/Streptomycin/L-Glutamate. The cultures were maintained in a humidified atmosphere containing 5% CO2 at 37°C.
Recombinant plasmid transfection
H9C2 cells were seeded in 6-well plates at a density of approximately 3 × 105 to 5 × 105 cells per well. The cells were then incubated at 37°C for 24 hours until they reached approximately 50% confluence. Following this, Lipofectamine™ 3000 Reagent was used to transfect the corresponding plasmids, including the empty vector control group, RNAi 1, RNAi 2, and RNAi 3, into the respective culture dishes. After 48 hours of transfection, cell fluorescence was assessed using a fluorescent microscope to evaluate fluorescent protein expression. The expression of green fluorescent protein in the transfected H9C2 cells was specifically observed 48 hours’ posttransfection.
RT-qPCR detection of UQCRC1 expression vector mRNA levels
RNA was extracted from cells transfected with different plasmids using an RNA extraction kit. The extracted RNA was then reverse transcribed into complementary DNA (cDNA) utilizing the HiScript II Q RT SuperMix for qPCR kit. PCR reactions were performed using primers specific to the UQCRC1 gene, with the following sequences: The upstream primer for UQCRC1 is 5’- CACACTGCTTACCTCATCAAG-3’, and the downstream primer is 5’-ATCACATCTCGCTCCTTCTC-3’. Real-time PCR was conducted using the QuantiNova™ SYBR® Green PCR Kit on a fluorescence quantitative PCR instrument. The relative expression level of UQCRC1 mRNA was calculated using the 2-ΔΔCt method, with GAPDH serving as the reference gene.
Western blot analysis of protein expression
Cells from different transfection groups were collected and resuspended in cell lysis buffer. The samples were vortexed and lysed for 30 minutes, followed by centrifugation at 12,000 rpm for 10 minutes at 4°C to collect the supernatant. The protein concentration in the supernatant was then measured using the BCA assay. Subsequently, polyacrylamide gel electrophoresis was performed, loading 30 μg of protein into each lane. The proteins were transferred onto a PVDF membrane, which was blocked with 10% skim milk for 2 hours. The membrane was then incubated overnight at 4°C with primary antibodies: UQCRC1 at a dilution of 1:1000 and GAPDH at a dilution of 1:5000. After the overnight incubation, the membrane was washed and incubated with Horseradish Peroxidase (HRP)-conjugated secondary antibodies at a dilution of 1:5000 for 1 hour at room temperature. Following this, the membrane was washed again, and the relative expression of the target protein was detected using chemiluminescence. Quantitative analysis was performed using ImageJ software.
Establishment of hypoxic cardio myocyte model
When H9C2 cardio myocytes reach 70%-80% confluence under standard culture conditions specifically, high-glucose DMEM supplemented with 10% Fetal Bovine Serum (FBS) at 37°C in a 5% CO2 atmosphere with 21% O2 , the culture medium is replaced with sugar-free DMEM containing 10% FBS. The cells are then incubated in a tri-gas incubator set to 5% CO2 , 94% N2 , and 1% O2 at 37 °C with saturated humidity for a duration of 12 hours.
Transmission electron microscopy observation of cellular ultrastructure under hypoxic culture
H9C2 cells from both the normal and hypoxic culture groups were collected and centrifuged at room temperature for 5 minutes at 1000 rpm. The cell pellets were then fixed with glutaraldehyde for 2 hours. Following fixation, the samples underwent standard electron microscopy processing, which included fixation, dehydration, infiltration, embedding, ultra-thin sectioning, and observation. The samples were examined and imaged using a transmission electron microscope.
Measurement of cell mitochondrial membrane potential (TMRE assay)
Cells from each group were uniformly seeded in 6-well plates at a density of 5 × 105 cells per well with a total volume of 2 mL per well. The cells were cultured routinely until they reached 80%-90% confluence. To assess mitochondrial membrane potential, the TMRE staining working solution was prepared. After removing the culture medium, the cells were washed with PBS and incubated with 1 mL of TMRE staining working solution at 37°C for 40 minutes in a cell culture incubator. Following incubation, the supernatant was removed, and the cells were washed again with PBS. The culture medium was then replaced with sugar-free complete culture medium, and the cells were subjected to hypoxic conditions for 12 hours. Changes in fluorescence intensity were observed using a fluorescence microscope. Additionally, cells were uniformly seeded in 96-well plates at approximately 2 × 104 cells per well and subjected to the same TMRE staining process and hypoxic culture for 12 hours. Fluorescence values were measured using a fluorescence microplate reader, with excitation and emission wavelengths set at 550 nm and 575 nm, respectively, under light-avoidance conditions. The data were subsequently statistically analyzed.
Fluorescence method for intracellular ROS content detection
Cells from each experimental group were routinely cultured until they reached 80%-90% confluence. After a 12-hour incubation under both normoxic and hypoxic conditions, the culture medium was aspirated. The fluorescent probe Dihydroethidium (DHE) was added to the cells at a final concentration of 10 µM, and the cells were incubated at 37°C for 30 minutes. Following the incubation, red fluorescence intensity was observed and captured using a fluorescence microscope while avoiding exposure to light. Quantitative analysis of the fluorescence intensity was subsequently performed.
Chemiluminescent method for cell ATP content detection
Cells from each experimental group were routinely cultured until they reached 80%-90% confluence and then subjected to hypoxic conditions for 12 hours. After the incubation period, the culture medium was aspirated, and 200 µL of cell lysis solution was added to each well to ensure thorough lysis of the cells. Following lysis, the samples were centrifuged, and the supernatant was collected for protein concentration determination using the BCA method. An ATP standard solution was prepared by diluting to appropriate concentrations (0.01 µM, 0.03 µM, 0.1 µM, 0.3 µM, 1 µM, 3 µM), according to the anticipated ATP concentration in the samples. An ATP detection working solution was then prepared. In a 96-well plate, 100 µL of the ATP detection working solution was added to each well. After allowing the solution to equilibrate for 5 minutes at room temperature, 20 µL of each sample was added to the wells and mixed rapidly. The ATP concentrations were subsequently measured using a chemiluminescence reader. ATP levels in the samples were calculated based on the standard curve and expressed as nmol/mg of protein for statistical analysis.
CCK-8 method for cell viability detection
Cells from each experimental group were uniformly seeded in a 96- well plate at a density of 5 × 103 cells per well in 100 μL of culture medium. The plates were placed in a CO2 incubator for 24 hours to allow for cell adhesion. After 24 hours, the culture medium was discarded, and the cells were washed with PBS. The medium was then replaced with sugar-free DMEM supplemented with 10% Fetal Bovine Serum (FBS) for hypoxic culture, which lasted 12 hours. Following the hypoxic incubation, 10 μL of CCK-8 detection solution was added to each well, and the cells were incubated at 37°C for an additional 2 hours. Before measurement, the microplate reader was set to shake for 20 seconds to ensure thorough mixing, and the absorbance at 450 nm was measured for each well. Cell viability was subsequently calculated based on the absorbance values for statistical analysis.
Enzyme-Linked Immunosorbent Assay (ELISA) for cell LDH content
Cells from each experimental group were uniformly seeded in a 96-well plate at a density of 5 × 103 cells per well in 100 μL of culture medium. The cells were cultured routinely until they reached 80%-90% confluency, after which they were subjected to hypoxic conditions for 12 hours. Following the hypoxic incubation, the 96- well plate was centrifuged using a multi-well centrifuge at 800 rpm for 5 minutes. After centrifugation, 120 µL of the supernatant from each well was transferred to a new 96-well plate. To each well, 60 µL of LDH detection working solution was added, mixed thoroughly, and the plate was incubated at room temperature, protected from light, for 30 minutes. After incubation, the absorbance at 490 nm was measured for each well using a microplate reader. The absorbance values were used to calculate cell toxicity for statistical analysis.
Statistical methods
Statistical analysis will be performed using Graph Pad Prism 8.0.2 software. Quantitative data will be expressed as x ± s (mean ± standard deviation). Comparisons between two groups will be conducted using a t-test, while comparisons among multiple groups will employ one-way Analysis of Variance (ANOVA). A significance level of (P<0.05) will be considered statistically significant.
Results
Identification of UQCRC1 plasmid vector transfection efficiency in H9c2 cells
Figure 1A The analysis showed that cells in each transfection group exhibited good growth status. Cells in the negative control group did not express green fluorescent protein (GFP). Conversely, the UQCRC1-silenced groups (RNAi 1, RNAi 2, RNAi 3) and the silenced empty vector control group exhibited a high abundance of GFP expression, with a positivity rate of approximately 70%.
Figure 1B RT-qPCR results indicated that the expression level of UQCRC1 mRNA in the UQCRC1 knockdown group was significantly lower than that in the negative control group and the knockdown empty vector group (P<0.05 for all comparisons).
Figure 1 Western blot analysis demonstrated that the protein expression level of UQCRC1 was significantly decreased in the RNAi sequence 1 group (1.039 ± 0.1051 vs. 0.5199 ± 0.07518) compared to the negative control and empty vector groups. The knockdown effects of RNAi sequences 2 and 3 were not statistically significant. Therefore, RNAi sequence 1 was selected for further experiments.
Figure 1: Identification of UQCRC1 plasmid vector transfection efficiency in H9C2 cells. (A) Fluorescent expression was observed under an inverted fluorescence microscope after transfection of H9C2 cells with the empty vector group, RNAi1, RNAi2, and RNAi3 plasmids for 48 hours. (B) RT-qPCR was conducted to detect the expression level of UQCRC1 mRNA. Compared to the empty vector control group, the results showed *P<0.01 and P<0.05. (C) Western blot analysis was performed to assess UQCRC1 protein expression levels. Compared to the empty vector control group, the results indicated *P<0.05, NSP>0.05.
Low expression of UQCRC1 exacerbates hypoxia-induced apoptosis and ultrastructural injury in H9c2 cardio myocytes
Figure 2A The apoptosis rate in the hypoxia group was significantly reduced compared to the control group (100.00 vs. 61.11 ± 0.32), with a significant difference (P<0.05). Additionally, compared to the hypoxia + empty vector group, cell viability in the hypoxia + RNAi 1 group was further decreased (58.88 ± 1.37 vs. 43.69 ± 0.25), again showing a significant difference (P<0.05).
Figure 2 Under normoxic conditions, H9C2 cells exhibited abundant cytoplasmic content and clearly visible mitochondrial structures. However, after 12 hours of hypoxia, cells in the empty vector group displayed disordered and swollen mitochondrial arrangements, with focal vacuolization, while chromatin and cytoplasmic contents appeared normal. In contrast, H9C2 mitochondria in the UQCRC1 knockdown group exhibited significant swelling, ridge fragmentation, and increased vacuole-like dissolution.
Figure 2: Low expression of UQCRC1 exacerbates hypoxiainduced apoptosis and ultrastructural injury in H9C2 cardio myocytes. (A) The upper: Hoechst staining image of H9C2 cells (apoptotic cells indicated by arrows). The lower: The percentage of apoptotic cells in the total number of cells in each group. Compared to the control group, *P<0.05; compared to the hypoxia+empty vector group, +P<0.05. (B) The red arrow indicates the mitochondria, and the scale is 1 µm. As shown as picture, the mitochondrial arrangement of H9C2 and empty carrier group cells was disordered and swollen, with focal cavitation phenomenon. There were no abnormal changes in chromatin and cytoplasmic contents; The UQCRC1 silencing group showed significant mitochondrial swelling, cristae rupture, and increased vacuolar dissolution in H9C2 cells.
Low expression of UQCRC1 exacerbates mitochondrial dysfunction in hypoxic H9c2 cardio myocytes
Figure 3 Cellular ATP levels in the hypoxic group were significantly reduced compared to the control group (23.56 ± 1.72 vs. 12.35 ± 1.16), with a significant difference (P<0.05). Furthermore, the hypoxia +RNAi 1 group displayed even lower ATP levels compared to the hypoxia+empty vector group (11.42 ± 1.11 vs. 7.35 ± 0.86), also showing significant differences (P<0.05).
Figure 3B The intensity of red fluorescence indicated reactive oxygen species (ROS) levels. The hypoxic group exhibited a significant increase in ROS (1.00 vs. 6.37 ± 0.97, P<0.05). Additionally, the hypoxia+RNAi 1 group showed a further increase in ROS levels compared to the hypoxia+empty vector group (5.91 ± 1.36 vs. 11.83 ± 1.12, P<0.05).
Figure 3C TMRE accumulates in the mitochondrial matrix, emits bright orange-red fluorescence. A significant reduction in mitochondrial membrane potential (MMP) led to TMRE release into the cytoplasm, resulting in diminished orange-red fluorescence intensity. Fluorescence microscopy revealed a significant decrease in MMP in hypoxic cells compared to controls (1.00 vs. 0.55 ± 0.10, P<0.05). The hypoxia+RNAi 1 group also showed a further reduction in MMP compared to the hypoxia+empty vector group (0.58 ± 0.092 vs. 0.14 ± 0.05, P<0.05).
Figure 3D Compared to the control group, cell viability in the hypoxia group significantly decreased (100.00 vs. 61.11 ± 0.32, P<0.05). The hypoxia+RNAi 1 group exhibited further decreased cell viability compared to the hypoxia+empty vector group (58.88 ± 1.37 vs. 43.69 ± 0.25, P<0.05). Additionally, LDH levels increased significantly in the hypoxia group compared to the control group (1.00 vs. 2.309 ± 0.314, P<0.05). The hypoxia+RNAi 1 group also demonstrated a further elevation in LDH content compared to the hypoxia+empty vector group (2.434 ± 0.452 vs. 4.729 ± 0.674, P<0.05).
Figure 3: The influence of UQCRC1 on mitochondrial function in H9C2 cells under hypoxic conditions includes lactate dehydrogenase, mitochondrial membrane potential, reactive oxygen species, and ATP. (A) The upper: Shows the mitochondrial membrane potential measurement image of H9C2 cells. The lower: Presents the statistical values of fluorescence density. *P<0.05 compared to the control group; +P<0.05 compared to the hypoxia+empty vector group. (B) The upper: Shows the reactive oxygen species measurement image of H9C2 cells. The lower: Presents the statistical values of fluorescence density. *P<0.05 compared to the control group; +P<0.05 compared to the hypoxia+empty vector group. (C) Compared to the control group, *P<0.05; compared to the hypoxia+empty vector group, +P<0.05. (d) The left: Shows the detection of H9C2 cell viability using the CCK-8 assay. The right: displays the measurement of lactate dehydrogenase content using the EnzymeLinked Immunosorbent Assay (ELISA). Statistical significance is denoted as *P<0.05 compared to the control group, and +P<0.05 compared to the hypoxia+empty vector group.
Discussion
Cardiovascular disease is one of the most common causes of death worldwide, and with changes in lifestyle and an aging population, the incidence of cardiovascular disease continues to rise. The heart is a mitochondrion-rich organ, with mitochondria constituting approximately one-third of the volume of cardiac myocytes. More than 90% of the energy required for the continuous contraction and relaxation activities of the heart is generated and supplied by mitochondria. Energy production in mitochondria primarily occurs through Oxidative Phosphorylation (OXPHOS), a process involving five enzymatically active complexes (I-V) located in the inner mitochondrial membrane. The electron transport chain is divided into the main and the secondary respiratory chains. The main respiratory chain begins with NADH and consists of complexes I, III, and IV. Electrons derived from NADH are sequentially transferred through these complexes. In contrast, the secondary respiratory chain initiates with FADH2 and comprises complexes II, III, and IV; electrons from FADH2 bypass complex I and are passed through the subsequent three complexes. The respiratory chain reactions not only facilitate the reduction of metabolic products by generating water from hydrogen atoms but also synthesize a significant amount of ATP, providing the necessary energy for various metabolic processes in the organism. Thus, the oxidative phosphorylation pathway plays a crucial role in mitochondrial energy production. Multiplestudies have revealed a close relationship between cardiovascular disease and mitochondrial physiological functions such as energy metabolism, OXPHOS, ATP production, and dynamic changes. Given the important role of mitochondria in cardiovascular diseases, studying the impact of changes in UQCRC1 protein content on mitochondrial function in myocardial cells is expected to become a new target for the prevention and treatment of cardiovascular diseases.
This study synthesized three pairs of shRNA UQCRC1 interference plasmids and transfected them into H9c2 cardio myocytes using a liposome method. The RNAi 1 interference fragment with the highest interference efficiency and transfection concentration were successfully screened, achieving low expression of exogenous UQCRC1 in H9c2 cells. Under hypoxic conditions, H9c2 cardio myocytes were cultured to simulate myocardial ischemia. We found that low expression of UQCRC1 exacerbated mitochondrial structural and functional damage in hypoxic H9c2 cardio myocytes, which was manifested by severe mitochondrial swelling, focal cavitation, cristae rupture, and intimal disappearance, as well as decreased cell viability, decreased ATP production, increased ROS expression, decreased MMP, and increased LDH activity. Our research indicates that UQCRC1 is crucial for maintaining mitochondrial structure and function stability, and its low expression can directly affect mitochondrial respiratory function and energy metabolism levels. The same evidence suggests that when mitochondrial dysfunction occurs, its expression levels decrease. Disrupting the UQCRC1 allele in mice can affect the formation and activity of complex III, and reduce ATP levels in the brain. In endothelial cells, interference with the expression level of UQCRC1 can lead to excessive ROS generation. Meanwhile, PCSK9 inhibits the function of mitochondrial complex III by downregulating UQCRC1, leading to an increase in ROS. In terms of cardiac protection, ischemia/reperfusion injury reduced the expression level of UQCRC1 in rat hearts, and its expression level was upregulated after administration of cardioprotective agents. Overexpression of UQCRC1 can increase the activity of mitochondrial complex III. The study by Yi Tingting et al. also suggests that overexpression of UQCRC1 in vitro may protect myocardial cells by binding to zinc ions. At the same level in vivo, it has been confirmed that low expression of UQCRC1 can increase the thickness of the ventricular septum during systole and diastole in mouse hearts, reduce the left ventricular volume during systole and diastole, and lead to mitochondrial vacuolization, disordered fiber arrangement, and severe changes in mitochondrial morphology and structure. These research results all suggest that UQCRC1 plays a crucial role in maintaining cardiac function. When myocardial cells are damaged by hypoxia, the expression level of UQCRC1 undergoes significant changes, which are regulated by its content and activity to maintain mitochondrial function.
Conclusion
In summary, diminished expression of UQCRC1 exacerbates mitochondrial damage in hypoxic H9C2 cardiomyocytes, indicating that UQCRC1 protein may serve as a critical target for ischemic myocardial protection. Investigating the UQCRC1 protein pathway holds the potential to unveil new clinical strategies and methodologies for the prevention and treatment of cardiovascular diseases.
Ethics Approval and Consent to Participate
The experimental protocol was approved by the Ethics Review Committee of the General Hospital of Ningxia Medical University (approval number 2020-01) and was conducted in accordance with the guidelines established by the National Institutes of Health, Animal Care and Use Committee.
Data Availability
The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.
Acknowledgements
We would like to extend our gratitude to Ms. Yipin Han (Johns Hopkins University, Bloomberg School of Public Health, Department of Epidemiology-Cardiovascular and Clinical Epidemiology, Baltimore, USA) for her valuable suggestions regarding the discussions and edits.
Author Contributions
Y.F., L.Y., and F.X. conceived and designed the study. Yucheng Fan and Fangjing Xu wrote the manuscript. G.L. and Z.C. conducted the cell culture, recombinant plasmid transfection, and Western blot analysis. K.F. performed the RT-qPCR experiments. J.H. and W.Y. established the hypoxic cardiomyocyte model. All authors have read and approved the final version of the manuscript.
Funding
This study was supported by the Ningxia Key R and D Project (talent introduction special project) (grant no. 2021BEB04035 to L.Y), Ningxia Medical University Key Research Project (grant no. XZ2024040 to Y.F.) and Ningxia Medical University General Research Project (grant no. XY2024138 to F.X.).
Competing Interests
The authors declare no competing interests.
References
- Schulte U (1989) . Nature 339: 147-149.
[] [] []
- Brandt U, Trumpower B (1994) Crit Rev Biochem Mol 29: 165-197.
[] [] []
- Zhang L (2013) . Circ Heart Fail 6: 1039-1048.
[] [] []
- Petersson SJ (2014) Eur J Endocrinol 171: 77-88.
[] [] []
- Kunej T (2007) Obesity 15: 2896-2901.
[] [] []
- Zeng J, Tao J, Xi L, Wang Z, Liu L (2021) . Int J Mol Med 47: 53.
[] [] []
- Xie WD (2010) . Mol Med Rep 3: 1047-1052.
[] []
- Wang J (2022) . Exp Ther Med 23: 85.
[] [] []
- Rasmussen UF, Krustrup P, Bangsbo J, Rasmussen HN (2001) Pflug Arch Eur J Phy 443: 180-187.
[] [] []
Citation: Xu F, Liu G, Chai Z, Fang K, He J, et al. (2025) Downregulation of UQCRC1 Exacerbates Hypoxia-Induced Mitochondrial Damage in H9C2 Cardio Myocytes. Diagnos Pathol Open 10: 257. DOI: 10.4172/2476-2024.1000257
Copyright: © 2025 Xu F, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.
Select your language of interest to view the total content in your interested language
Share This Article
Open Access Journals
Article Tools
Article Usage
- Total views: 512
- [From(publication date): 0-0 - Jul 24, 2026]
- Breakdown by view type
- HTML page views: 434
- PDF downloads: 78



