Epidemiological Studies and Molecular Characterization of Herpes Simplex Virus among Urban Population in Chennai, Tamilnadu

ÖйúPÕ¾

ISSN: 2161-1165
Epidemiology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
  • Research Article   
  • Epidemiology (Sunnyvale) 2015, Vol 5(2): 187
  • DOI: 10.4172/2161-1165.1000187

Epidemiological Studies and Molecular Characterization of Herpes Simplex Virus among Urban Population in Chennai, Tamilnadu

Saran N1,2*, Bupesh G1, Magesh S1, Vennila S1, Anandharaj B2, Anupama CP1, Kaveri K1 and Gunasekaran P1
1Department of Virology, King Institute of Preventive Medicine and Research, Guindy, Chennai, India
2Department of Microbiology, M.R. Govt. College, Mannargudi, India
*Corresponding Author: Saran N, Department of Virology, King Institute of Preventive Medicine and Research, Guindy, Chennai, India, Email: kaveri_raj1967@yahoo.com

Received: 28-Apr-2015 / Accepted Date: 23-Jun-2015 / Published Date: 27-Jun-2015 DOI: 10.4172/2161-1165.1000187

Abstract

Background: Herpes infections were caused predominantly by sexually transmission diseases. Especially the Herpes simplex viruses 1 and 2 appear in many parts of the body. Dermatologists were difficult to diagnose the infections, they can identify after performing blood and CSF tests. Prevalence of age and sex of herpes infections is important to optimize for herpes control strategies. Therefore the study was conducted to assess the epidemiological and molecular characteristics of Herpes Simplex Virus in the northern districts of south India, Tamil Nadu, Chennai.

Methodology: Samples from the northern districts of south India, TamilNadu, Chennai were accounted for the study. A total of 1244 serum and 163 CSF samples were examined for the prevalence of HSV from January 2013 to December 2013. Seroprevalence of the HSV was detected using the commercial IgM ELISA in study area. The positive samples were then subjected for Nested Polymerase Chain Reaction in CSF samples. The data were collected by and analyzed by statistical software using SPSS version 20.

Results: Neonates (0-1yr) showed higher positivity for HSV infection. The statistical analysis revealed that the Male gender were ranges from 0-12yrs were highly susceptible for the HSV infection and above 12yrs were poorly susceptible and month wise data showed higher prevalence was in november and december. The HSV nested PCR were performed and it was developed as marker for the molecular diagnosis for HSV infection. 282 bp of glycoprotein gene was amplified and it was characterized to detect the HSV in CSF samples.

Conclusion: Herpes simplex virus infection in the northern districts of South India reveals that the male populations have significant prevalence than the female gender. Further the neonates with 0-1yr age indicate higher positivity. This finally concludes that the transmission HSV from mother to fetus occurs significantly high.

Keywords: Herpes Simplex Virus; ELISA; PCR; Epidemiology and Molecular Characterization

163283

Introduction

Herpes virus (HSV) is an important human pathogen cause sexually transmitted disease [1,2]. Herpes simplex viruses are associated with the severe symptoms of ulceration in the organs. Furthermore the serious clinical symptoms were keratitis, neonatal infection and . The major cases were associated with fatal sporadic encephalitis. It occurs in 10 to 20% of viral encephalitis cases annually. HSV1 mainly cause oral ulceration whereas the HSV2 lead to genital ulceration due to their secretions and lesions. In human thus it transmits through contact by skin and saliva [3,4]. HSV viruses were DNA viruses distributed worldwide and occur in both developed countries such as Germany, Spain and Norway and developing countries in the last two decades [5]. Symptomatic and Asymptomatic infections were detected by type specific enzyme immunoassays (ELISA) that reliably discriminate between antibodies to HSV-1 and HSV-2, to facilitate serological studies. The Symptomatic infection of HSV cases roots psychological disorders, physical discomfort, and interferes with sexual relations [6]. Predominantly many of genital infections are transmitted by persons unacquainted on their infection which were asymptomatic while transmission ensued. HSV-2 prevalence is extensively higher with women on infertility health centers [7] and Genital herpes can be occur to the baby during delivery via birth canal [8]. Regular surveillance is delayed as many of those infected remain asymptomatic and are not presented to the health services [9]. Therefore the present study portrays the epidemiology and molecular characterization of HSV infections in urban population of Chennai.

163284

Materials and Methods

Study population

This study was performed from January 2013 to December 2013. Total of 1244 serum and 163 CSF samples were collected from highly suspected cases in patients attending antenatal clinic at government hospitals in and around Chennai as well as from other neighboring districts. Complete details of etiology with patients such as physical examination, age, sex, contact history, date of on set, occupation and other risk factors were also collected from the patients, with the help of lab request form (LRF) [3].

Enzyme linked immune sorbent assay (ELISA)

Serum samples were tested for the presence of IgM antibodies kits obtained from DIA.PRO, ITALY. Test was performed as per the manufacturer’s instructions.

DNA extraction and nested PCR

The DNA extractions from CSF samples were done by using QIA amp Viral DNA KIT (Qiagen). Further it was detected by conventional nested PCR using the primers for G gene OR-5’-TCCGG GGCA GCAGGGTGCT-3’ OF-5’-ATCCGAACGCAGCCCCGCTG-3’ yielding 320 bp product. IR-5’AGCTG TATASGGCGACG GTG-3’ and IF-5’-GCGCCGTCAGCGAGGATAAC-3’. These oligonucleotide primers amplify 282 bp of gene

DNA Extracted was amplified with first set of HSV specific primers using 5 μl template and then 3 μl of the PCR product was used for a second round of amplification using HSV specific nested primers. The amplification was performed as follows initial denaturation step at 94°C for 5 minutes, followed by 35 cycles of (94°C for 45 sec; 57°C for 45 secs and 72° for 1 secs and a final extension step at 72°C for 10 minutes) 4°C for infinity. First round pcr followed by second round amplification with same cycling conditions and 25 cycles. PCR products were analyzed in 1.5% agarose gel electrophoresis. Product from HSV primer 1 was 380 bp and of HSV primer 2 was 282 bp. The gel was viewed under Alpha Imager (AlphaInnotechSan Diego, California, USA) and the resulting bands were captured with a Polaroid camera.

163285

Statistical Analysis

The Data was statistically analyzed by the software SPSS.20 IBM version. Specific type distribution was assessed by multivariate analysis of sex, Age, Month-season wise and positive samples were performed. Totally 1244 samples were studied throughout year of 2013 with respect to months.

163286

Results

The Prevalence of HSV was evaluated in 1244 serum samples from northern districts of Chennai January 2013-Dec 2013. Samples were screened by HSV IgM ELISA. 163 CSF samples suspected for the HSV infection were tested with Nested Polymerase chain reaction. Samples were collected from different age groups viz 0-45 yrs and above 45 yrs. Among the age groups the HSV prevalence in men were found to be high when compared to women. Particularly men age group below 1 yr was shown high positive samples in Table 1. Similarly 1-5 yrs (7.6%) and 6-12 (12.2%) yrs age group men showed high positive when compared to the women sex (Table 1) statistically significant (P<0.05). Further male samples were shown high hsv prevalence than women samples screened at 2013.

Sample Age Sex Total samples Positive    Percentage Negative Percentage
Serum 0-1 Male 280 17 6.07% 263 93.90%
  Female 183 7 3.80% 176 96.10%
Serum 1-5Yrs Male 183 14 7.60% 169 92.30%
  Female 139 5 3.50% 134 96.40%
Serum 6-12Yrs Male 103 13 12.60% 90 87.30%
  Female 75 4 5.30% 71 94.60%
Serum 13-18Yrs Male 37 1 2.70% 36 97.20%
  Female 23 2 8.60% 21 91.30%
Serum 19-30Yrs Male 45 4 8.80% 41 91.10%
  Female 36 7 19.40% 29 80.50%
Serum 31-45Yrs Male 45 5 11.11% 40 88.80%
  Female 29 1 3.44% 28 96.50%
Serum Above 45yrs Male 39 2 5.12% 37 94.80%
  Female 27 3 11.11% 24 88.80%

Table 1: Month-wise distribution of suspected cases of (HSV) IgM positive cases during the period of January-13 to December-13.

Month wise distribution of the HSV samples of both sexes has been shown in Figure 1. The statistical analysis of multivariate regression showed that the HSV prevalence in the serum was irrespective to the age and it is found to be higher in the age below thirteen years and high positive were found irrespective to the age above thirteen up to forty five years all data were compared significantly at P<0.05.

epidemiology-Positive-cases-Serum

Figure 1 A: Month wise distribution of HSV suspected cases in 2013, B: Distribution of Positive cases in Serum and C: Distribution of Negative cases in Serum.

The prevalence of HSV in CSF samples was analyzed (Figure 2 and Table 2). Age groups 0-1 and 1-5 yrs showed high positivity than all the age groups displayed in the Table 2. The infectivity pattern of HSV by SPSS analysis was notably significant (P<0.05) higher in the female than the male gender.

epidemiology-Distribution-Positive-cases

Figure 2 A: Month wise distribution of HSV CSF suspected cases in 2013, B: Distribution of Positive cases in CSF and C: Distribution of Negative cases in CSF.

Sample Age Sex Total samples Positive Percentage Negative Percentage
CSF 0-1 Male 19 4 21 15 78.9
Female 17 6 35.2 11 64.7
CSF 1-5Yrs Male 21 5 23.8 16 76.1
Female 14 5 35.7 9 64.2
CSF 6-12Yrs Male 18 3 16.6 15 83.3
Female 12 2 16.6 10 83.3
CSF 13-18Yrs Male 6 0 0 6 100
Female 2 1 50 1 50
CSF 19-30Yrs Male 11 2 18.1 9 81.8
Female 13 2 15.3 11 84.6
CSF 31-45Yrs Male 7 2 28.5 5 71.4
Female 6 0 0 6 100
CSF Above 45yrs Male 11 0 0 11 100
Female 5 0 0 5 100

Table 2: Month-wise distribution of suspected cases of (HSV) CSF-PCR positive cases during the period of January-13 to December-13.

HSV detection at molecular level was done by conventional nested PCR. The oligonucle-otides amplify a 282-bp region sequences of the glycoprotein (gp) G gene using nested PCR in which sense the primers OR-5’TCCGGSGGCAGCAGGGTGCT3’ (Sense) OF- 5’ATC CGAAC GCAGC CCCGCTG3’ (Antisense) yielding a 380 bases. IR-5’AGCTGTATA SGGCG ACGG TG3’ (sense) and IF-5’GCGCCGTCAGCGAGGATAAC3’ (antisense). The oligonucleotide primers of gp gene amplify 282 base pairs which was shown in the Figure 3 confirms the positivity of CSF samples. Thus the present study was highly helpful to develop a marker for HSV diagnostics using Conventional PCR.

epidemiology-NC-Negative-control

Figure 3: Molecular detection of glycoprotein G 282bp using nested conventional PC. Lane M:Marker DNA ladder100-1000bp, Lane 1,2,4,5 CSF positive samples, Lane 3,6,7,8 Negative CSF Samples , Lane NC-Negative control, Lane PC-Positive control.

163287

Discussion

The age wise distributions of samples were accounted for the hsv prevalence in the different parts of in and around Chennai. In contrast among the age group the 0-12 years samples were occurred as 77% than the other age groups. Gender wise populations were analyzed for the prevalence of HSV susceptibility. The statistical analysis interprets that the male gender revealed higher susceptibility than the female. Similarly the high positive samples were found in the male gender than the female. Many reports were similarly done in seroprevalence of HSV [10]. But this paper analyzes statistically the gender wise, month wise susceptibility of samples in the different demography in and around Chennai. Among the sample wise distribution the serum samples were detected for HSV through the presence of subsequent antibodies and the CSF samples were analyzed for the subsequent presence of HSV genes in samples. The occurrence of HSV sample size was very low in CSF when compared to the antibody detection in serum. These research findings were already followed by the previous study in which the parameters were correlated with age and severity of disease [11].

Month wise distributions of occurrence of samples were appraised for epidemiological analysis. The month wise distributions were related to the occurrence of HSV susceptibility in different seasons. In the month of November, both genders were occurred more than rest of other months. Especially the male samples were revealed as higher occurrence than the female gender. The positive samples were started to occur in the prewinter season and elevated in the winter (month of December). This indicates that the samples were incubated and immediately detected in the month of September. Further it was elevated in the end of winter season. Similarly more number of negative samples was occurred in the month of November.

The conventional PCR using glycoprotein G gene primers were successfully used for diagnostics and screen the HSV in CSF samples. The oligonucleotide primer amplifies 282 bp of gene in CSF. Finally the detection of HSV infection by PCR revealed significant marker development in diagnosis.

163288

Acknowledgements

The authors are very grateful to the funding agencies ICMR, DST, DME, TamilNadu, Chennai and King Institute of Preventive Medicine and Research, Guindy, Chennai for their adequate laboratory support and contributions to this work.

163289

References

  1. Prathiba G, Joseph L, Pushpa Innocent D (2012) HSV-2 Seroprevalence in infertile population J. Microbiol Biotech Res2: 922-925

Citation: Saran N, Bupesh G, Magesh S, Vennila S, Anandharaj, et al. (2015) Epidemiological Studies and Molecular Characterization of Herpes Simplex Virus among Urban Population in Chennai, Tamilnadu. Epidemiology (sunnyvale) 5:187. DOI: 10.4172/2161-1165.1000187

Copyright: © 2015 Saran N, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Select your language of interest to view the total content in your interested language

Post Your Comment Citation
Share This Article
Article Tools
Article Usage
  • Total views: 16883
  • [From(publication date): 6-2015 - Apr 07, 2026]
  • Breakdown by view type
  • HTML page views: 12087
  • PDF downloads: 4796
Share This Article

Review summary

  1. melisa
    Posted on Jan 23 2017 at 5:32 pm
    I am really happy that i have been cured from (HERPES SIMPLEX VIRUS) with the herbal medicine of DR ADEMUSHI, i have been suffering from this disease for the past 2 years and 7 mouth without solution until i came across the email of this doctor who have cure so many people with his herbal medicine, i also choose to give him a chance to help me and my husband, he told me what to do and i kindly did it, and he gave us his herbal medicine and direct me on how to use it, i also follow his instructions for use and he ask us to go for a check up after 1 week and 4days which i did, to my greatest surprise our result came out as negative, we are really happy that there is someone like this doctor who is ready to help anytime any day. To all the readers and viewers that is doubting this testimony stop doubting it and contact this doctor if you really have one and see if he will not actually help you. i am not a stupid woman that i will come out to the public and start saying what someone have not done for me and i know that there are some people out there who are really suffering and hurting their family just because of these diseases so you can to mail him on drademushiherbalhome@hotmail.com he also told me that he has cure for these diseases listed below: .DIABETES .CANCER .HEPATITIS .HIV/AIDS E.T.C.
  2. Olivia
    Posted on Nov 12 2016 at 3:08 pm
    I want to share this wonderful testimony to the people all over the world on how i was cured of herpes disease by Dr Ozil. i was living with herpes for the past two years, just last month as i was browsing on the internet about this deadly disease, i saw a testimony of somebody called Flora, testifying of how she was cured from herpes by Dr Ozil and i decided to also email this Dr Ozil via drozilsolutionhome@gmail.com and tell him about my problem, he told me to send him some of my personal details which i did and then he prepare the treatments and send them to me through DHL. he give me the instructions on how to use the treatment for 7 days and after 7 days, he told me to go for herpes test which i did and to my greatest surprise i was confirmed negative. all thanks be to Dr Ozil and God almighty for curing me of this deathly disease after 2 years and if you know that you are in this same problem email him now on drozilsolutionhome@gmail.com or you can also visit his website via http://drozilsolutionhome.webs.com/ and i strongly believe that he will help you just as he did mine
  3. Olivia
    Posted on Nov 12 2016 at 3:07 pm
    I want to share this wonderful testimony to the people all over the world on how i was cured of herpes disease by Dr Ozil. i was living with herpes for the past two years, just last month as i was browsing on the internet about this deadly disease, i saw a testimony of somebody called Flora, testifying of how she was cured from herpes by Dr Ozil and i decided to also email this Dr Ozil via drozilsolutionhome@gmail.com and tell him about my problem, he told me to send him some of my personal details which i did and then he prepare the treatments and send them to me through DHL. he give me the instructions on how to use the treatment for 7 days and after 7 days, he told me to go for herpes test which i did and to my greatest surprise i was confirmed negative. all thanks be to Dr Ozil and God almighty for curing me of this deathly disease after 2 years and if you know that you are in this same problem email him now on drozilsolutionhome@gmail.com or you can also visit his website via http://drozilsolutionhome.webs.com/ and i strongly believe that he will help you just as he did mine
  4. Olivia
    Posted on Nov 12 2016 at 2:59 pm
    I want to share this wonderful testimony to the people all over the world on how i was cured of herpes disease by Dr Ozil. i was living with herpes for the past two years, just last month as i was browsing on the internet about this deadly disease, i saw a testimony of somebody called Flora, testifying of how she was cured from herpes by Dr Ozil and i decided to also email this Dr Ozil via drozilsolutionhome@gmail.com and tell him about my problem, he told me to send him some of my personal details which i did and then he prepare the treatments and send them to me through DHL. he give me the instructions on how to use the treatment for 7 days and after 7 days, he told me to go for herpes test which i did and to my greatest surprise i was confirmed negative. all thanks be to Dr Ozil and God almighty for curing me of this deathly disease after 2 years and if you know that you are in this same problem email him now on drozilsolutionhome@gmail.com or you can also visit his website via http://drozilsolutionhome.webs.com/ and i strongly believe that he will help you just as he did mine
  5. Mabel
    Posted on Nov 11 2016 at 4:20 pm
    I have been through a lot just trying to get my Herpes cured which i have write to different herbal doctors on the internet with no solution. i spoke to someone here in the united state who told me about Dr Fred that got her cousin cured with just 4 weeks of taking his remedy. Dr Fred is an Africa america Herbal doctor who base here in the United State but practice his profession in West Africa. I got myself cured after which i call him on his mobile telling his my problem and he gave me an herbal remedy which i took and today i am cured totally from Herpes. just call his agent here +19183763392. also write to his direct email: drfredherbalcuringcenter@yahoo.com and West Africa whatsapp contact: +2348139097317

Review summary

  1. melisa
    Posted on Jan 23 2017 at 5:32 pm
    I am really happy that i have been cured from (HERPES SIMPLEX VIRUS) with the herbal medicine of DR ADEMUSHI, i have been suffering from this disease for the past 2 years and 7 mouth without solution until i came across the email of this doctor who have cure so many people with his herbal medicine, i also choose to give him a chance to help me and my husband, he told me what to do and i kindly did it, and he gave us his herbal medicine and direct me on how to use it, i also follow his instructions for use and he ask us to go for a check up after 1 week and 4days which i did, to my greatest surprise our result came out as negative, we are really happy that there is someone like this doctor who is ready to help anytime any day. To all the readers and viewers that is doubting this testimony stop doubting it and contact this doctor if you really have one and see if he will not actually help you. i am not a stupid woman that i will come out to the public and start saying what someone have not done for me and i know that there are some people out there who are really suffering and hurting their family just because of these diseases so you can to mail him on drademushiherbalhome@hotmail.com he also told me that he has cure for these diseases listed below: .DIABETES .CANCER .HEPATITIS .HIV/AIDS E.T.C.
  2. Olivia
    Posted on Nov 12 2016 at 3:08 pm
    I want to share this wonderful testimony to the people all over the world on how i was cured of herpes disease by Dr Ozil. i was living with herpes for the past two years, just last month as i was browsing on the internet about this deadly disease, i saw a testimony of somebody called Flora, testifying of how she was cured from herpes by Dr Ozil and i decided to also email this Dr Ozil via drozilsolutionhome@gmail.com and tell him about my problem, he told me to send him some of my personal details which i did and then he prepare the treatments and send them to me through DHL. he give me the instructions on how to use the treatment for 7 days and after 7 days, he told me to go for herpes test which i did and to my greatest surprise i was confirmed negative. all thanks be to Dr Ozil and God almighty for curing me of this deathly disease after 2 years and if you know that you are in this same problem email him now on drozilsolutionhome@gmail.com or you can also visit his website via http://drozilsolutionhome.webs.com/ and i strongly believe that he will help you just as he did mine
  3. Olivia
    Posted on Nov 12 2016 at 3:07 pm
    I want to share this wonderful testimony to the people all over the world on how i was cured of herpes disease by Dr Ozil. i was living with herpes for the past two years, just last month as i was browsing on the internet about this deadly disease, i saw a testimony of somebody called Flora, testifying of how she was cured from herpes by Dr Ozil and i decided to also email this Dr Ozil via drozilsolutionhome@gmail.com and tell him about my problem, he told me to send him some of my personal details which i did and then he prepare the treatments and send them to me through DHL. he give me the instructions on how to use the treatment for 7 days and after 7 days, he told me to go for herpes test which i did and to my greatest surprise i was confirmed negative. all thanks be to Dr Ozil and God almighty for curing me of this deathly disease after 2 years and if you know that you are in this same problem email him now on drozilsolutionhome@gmail.com or you can also visit his website via http://drozilsolutionhome.webs.com/ and i strongly believe that he will help you just as he did mine
  4. Olivia
    Posted on Nov 12 2016 at 2:59 pm
    I want to share this wonderful testimony to the people all over the world on how i was cured of herpes disease by Dr Ozil. i was living with herpes for the past two years, just last month as i was browsing on the internet about this deadly disease, i saw a testimony of somebody called Flora, testifying of how she was cured from herpes by Dr Ozil and i decided to also email this Dr Ozil via drozilsolutionhome@gmail.com and tell him about my problem, he told me to send him some of my personal details which i did and then he prepare the treatments and send them to me through DHL. he give me the instructions on how to use the treatment for 7 days and after 7 days, he told me to go for herpes test which i did and to my greatest surprise i was confirmed negative. all thanks be to Dr Ozil and God almighty for curing me of this deathly disease after 2 years and if you know that you are in this same problem email him now on drozilsolutionhome@gmail.com or you can also visit his website via http://drozilsolutionhome.webs.com/ and i strongly believe that he will help you just as he did mine
  5. Mabel
    Posted on Nov 11 2016 at 4:20 pm
    I have been through a lot just trying to get my Herpes cured which i have write to different herbal doctors on the internet with no solution. i spoke to someone here in the united state who told me about Dr Fred that got her cousin cured with just 4 weeks of taking his remedy. Dr Fred is an Africa america Herbal doctor who base here in the United State but practice his profession in West Africa. I got myself cured after which i call him on his mobile telling his my problem and he gave me an herbal remedy which i took and today i am cured totally from Herpes. just call his agent here +19183763392. also write to his direct email: drfredherbalcuringcenter@yahoo.com and West Africa whatsapp contact: +2348139097317

Post your comment

captcha   Reload  Can't read the image? click here to refresh
Peer Reviewed Journals

Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals

International Conferences 2026-27
 
Meet Inspiring Speakers and Experts at our 3000+ Global

Conferences by Country

Medical & Clinical Conferences

Conferences By Subject

Top Connection closed successfully.