ÖйúPÕ¾

PPARα; Expression; Skeletal muscle; Development

Skeletal muscles, as the largest muscle tissue in animals, account for about 40% of the total weight of healthy animals. In addition to support and exercise functions, they are also the main tissues that consume energy. Skeletal muscle functions are closely related to types of muscle fibers and the growth and development of muscle fibers mainly rely on the proliferation and differentiation of muscle cells. Accordingly, skeletal muscle-related diseases are intimately linked to the growth and development processes of muscle cells. The investigation of skeletal muscle is of great significance for elevating the economic value of animals and promoting the development of animal husbandry [1].

PPARα, as a subtype of Peroxisome Proliferators Activated Receptors (PPARs), is mainly expressed in high-energy tissues including skeletal muscles. As a metabolic nuclear receptor, PPARα plays a crucial role in regulating systemic metabolic homeostasis and its expression changes are observed in many diseases caused by lipid metabolism disorders.

PPAR subtypes are important in metabolism and body energy homeostasis and PPARα has been reported to be involved in regulating fatty acid intake, β oxidation and ω oxidation. PPARα is activated in a fasting state of mice and it is involved in regulating glucose homeostasis through the AMP-activated Protein Kinase (AMPK) and rapamycin target protein (mTOR) signalling pathways. After being activated, PPARα can improve the expression of Pyruvate Dehydrogenase Kinase 4 (PDK4), thereby regulating blood sugar content. In addition, PPARα can also regulate liver size and liver regeneration by activating the YAP-TEAD signaling pathway and PPARα can mediate the regulation of lipid metabolism by mTORC2, thereby promoting liver regeneration.

PPARα, a key transcription factor, has been demonstrated to facilitate the healing of endothelial cell damage by enhancing the expression of CCL14 in human umbilical vein endothelial cells. These above findings jointly indicate that PPARα also plays an indispensable role in tissue regeneration [2].

Skeletal muscle-related research reveals that PPARα can prevent skeletal muscle atrophy caused by liver cancer-induced anorexic cachexia syndrome, suggesting that PPARα regulates skeletal muscle mass through the liver muscle axis. The effects of PPARα on skeletal muscle atrophy and inflammation have been widely reported. Previous studies have demonstrated that PPARα is a key gene in skeletal muscle antioxidation and anti-inflammation pathways. Generally, the existing studies of PPARα are mostly focused on its effect on glycolipid metabolism and the skeletal muscle-related research mainly focuses on the effect of PPARα on energy metabolism and inflammation. However, there is lack of the research on the role of PPARα in skeletal muscle development.

The purpose of our study is to reveal the expression characteristics of PPARα at different development stages of skeletal muscle in vivo. The results showed pronounced differences in the expression levels of PPARα in skeletal muscle in different age groups. Specifically, juvenile mice exhibited the highest skeletal muscle content, whereas aged mice displayed the lowest. Our results demonstrated the potential important role of PPARα in skeletal muscle development. Our findings lay a foundation for the further exploration of functions and mechanisms of PPARα in skeletal muscle development [3].

Sample collection

The experiment animals used in this study were C57BL/6J male mice at different stages of development. Healthy animals were selected including young mice 6-8 weeks old, adult mice 3-4 months old, aged mice 18-20 months old. Gastrocnemius muscles were collected from each mouse, with left leg gastrocnemius muscle flashfrozen in liquid nitrogen and stored in a -80°C for RNA and protein extraction. The right leg gastrocnemius muscle with tendon was fixed in 4% paraformaldehyde solution for 24-36 h for subsequent HE staining and immunofluorescence assay [4].

HE staining

After fixation, mouse gastrocnemius muscle samples were embedded in paraffin and sliced into 7 μm by a microtome (CM1850, Leica). The HE staining was performed following the manufacturers’ instructions. The HE staining images of gastrocnemius muscle sections were captured with an ECLIPSE Ts2R (Nikon, China) microscope.

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) was performed in a 10 μL reaction system containing 1 μL cDNA template, 3.2 μL DEPC water, 5 μL Mix, 0.4 μL the upstream primer and 0.4 μL downstream primers, with DEPC (diethyl pyrocarbonate) water as the negative control, liver tissue cDNA as the positive control and gastrocnemius muscle tissue cDNA as detection target. The upstream primer sequence of PPARα was CCTCAGGGTACCACTACGGA and its downstream primer sequence was TTGCAGCTCCGATCACACTT. The PCR was performed as follows: Pre-denaturation at 95℃ for 30 s, followed by 35 cycles of denaturation at 95℃ for 40 s, annealing at 60℃ for 30 s and extension at 72℃ for 40 s [5].

PCR products were subjected to 1% agarose gel electrophoresis. Briefly, 5 μL of DL500 DNA marker, 10 μL DEPC water, 10 μL liver tissue cDNA, 10 μL of gastrocnemius muscle tissue cDNA were added to the well, and electrophoresis was performed at 220 V.

RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR)

RNA was extracted from mouse gastrocnemius muscle using the Trizol reagent (TaKaRa Bio, Dalian, China) and reverse transcription of RNA was performed according to the instructions of the reverse transcription kit (TOLOBIO, Shanghai, China) to synthesize cDNA.

The primers of PPARα and 36B4 were synthesized by Universal Biology (Anhui, China).

Real-time fluorescence quantitative PCR was performed in 10 μL total reaction system containing 4.4 μL cDNA (diluted 20 times with DEPC water), 5 μL SYBR Premix Ex Taq (Mona, Suzhou, China), 0.3 μL the upstream primer and 0.3 μL downstream primer. The upstream primer sequence of PPARα was CCTCAGGGTACCACTACGGA and its downstream primer sequence was TTGCAGCTCCGATCACACTT. The upstream primer sequence of 36B4 was ACTGAGATTCGGGATATGCTGT and its downstream primer sequence was CCCACCTTGTCTCCAGTCTTTA. There were 7 biological replicates of each gastrocnemius muscle age group. The procedures of qRT PCR were as follows: pre-denaturation at 95°C for 1 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s, ending up with extension at 95°C for 15 s. The relative expression of PPARα was analyzed in different developmental stages of skeletal muscle using the 2-ΔΔCT method [6].

Western blot

The protein was extracted from muscle tissues with RIPA buffer (Beyotime Biotechnology, Shang hai, China) containing protease and phosphatase inhibitors (Servicebio, China). Total protein concentration was determined using BCA protein assay kit (Beyotime Biotechnology, Shanghai, China). The proteins were subjected to SDSPAGE electrophoresis and the obtained proteins were transferred onto PVDF membranes by semi-dry transfer method (Trans-blot Turbo, Bio-Rad Laboratories) at 1 amp for 10 min. Afterwards, the PVDF membranes were blocked with 5% skim milk at 37℃ for 1 hour, incubated with PPARα antibody (23995-1-AP, Proteintech, Wuhan, China) and GAPDH (10494-1-AP, Proteintech) at 4℃overnight. After being washed five times with TBST (Tris-Buffered Saline with 0.1% Tween 20), the membranes were incubated with either anti-mouse or anti-rabbit IgG HRP-linked secondary antibody (1:25000 dilution, Abclonal Technology, China). The protein bands were visualized using a chemiluminescence reagent (Beyotime Biotechnology, Shanghai, China). The quantitative analysis of protein bands was performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA) [7].

Immunofluorescence assay

Paraffin-fixed muscle sections were dewaxed by xylene and gradient alcohol, immersed in 1× sodium citrate antigen retrieval solution for antigen retrieval in a microwave oven, then naturally cooled to room temperature, washed with PBS solution (3 × 5 min), blocked with dropwise added 3% goat serum at room temperature for 30 min, rewashed again with PBS solution three times for 5 min per time (3 × 5 min) and incubated with added dropwise PPARα, P21 or P53 antibodies (diluted at 1:200) overnight at 4°C. Subsequently, muscle sections were rewarmed at room temperature for 30 min, rinsed with PBS solution (3 × 5 min), added with 0.025% fluorescent secondary antibody dropwise, incubated at room temperature in the dark for 1 h, then re-rinsed with PBS solution (3 × 5 min), finally added with DAPI agent dropwise and incubated in incubator with coverslip. The immunofluorescence images of muscle sections were captured with an ECLIPSE Ts2R microscope.

Statistical analysis

All experimental data were analyzed and processed using GraphPad Prism 5.0 software, and the statistical difference among groups were determined using T-test. P<0.05 was considered as statistically significant.

Morphological changes in gastrocnemius muscle of young, adult and aged mice

To investigate the morphological alterations in skeletal muscles throughout mouse various developmental stages, Hematoxylin and Eosin (HE) staining was performed to visualize the skeletal muscle morphology. The results revealed a reduction in the cross-sectional area of the gastrocnemius muscle with increasing age. The young mice displayed a dense muscle fiber arrangement (Figure 1a), adult mice exhibited a less dense arrangement (Figure 1b), whereas aged mice exhibited loose arrangement (Figure 1c) [8].

Figure 1: Morphological changes of mouse gastrocnemius muscle at different age stages (a) Young mouse gastrocnemius muscle. (b) Adult mouse gastrocnemius muscle. (c) Aged mouse gastrocnemius muscle. Scale bar=250 μm.

Immunofluorescence assay of P21 and P53 in skeletal muscle and changes in their expressions in skeletal muscle at mouse different age stages

Further, we performed immunofluorescence staining of cell cycle and apoptosis markers P21 and P53 from the gastrocnemius muscle of young, adult and aged mice to investigate their expression levels. Immunofluorescence staining results showed that P21 and P53 were expressed in skeletal muscle at all age stages and as age increased, the expression levels of P21 and P53 in skeletal muscle gradually increased. The expression levels of P21 and P53 were highest in the gastrocnemius muscle of aged mice, which was consistent with the impact of aging on them. Both P21 and P53 were expressed in the nuclei of skeletal muscle. Overall, the expression levels of these two proteins were increased in skeletal muscle with increasing age (Figure 2) [9].

Figure 2: Immunofluorescence assay of P21 and P53 in gastrocnemius muscle. (a) Immunofluorescence assay of P21 in gastrocnemius muscle at different age stages (b) Immunofluorescence assay of P53 in gastrocnemius muscle at different age stages DAPI (blue) shows nuclei. Scale bar=200 μm.

Expression verification of PPARα in skeletal muscle by PCR

To explore the role of PPARα in skeletal muscle development, we initially investigated the expression of PPARα in skeletal muscle tissue. PPARα has been reported to be highly expressed in the liver. To examine whether of PPARα was expressed in skeletal muscle, we used liver cDNA as a positive control. The electrophoresis results showed that the PPARα band corresponding to the gastrocnemius muscle was clear without tailing (Figure 3) verifying the expression of PPARα in the gastrocnemius muscle of mice.

Figure 3: PCR verification of PPARα expression in gastrocnemius muscle. Lane M, DL500 DNA marker; Lane 1, negative control (DEPC water); Lane 2, positive control (liver tissue cDNA); Lane 3, target band (gastrocnemius muscle cDNA).

Expression level of PPARα in gastrocnemius muscle of mice at different age stages by Western blot and real-time quantitative PCR

We detected the protein and mRNA expression of PPARα in the gastrocnemius muscle of young, adult and aged mice through Western blot and Real-time quantitative PCR. At the protein level, PPARα showed a higher expression level in the gastrocnemius muscle of young mice than that of adult and aged mice, with a lowest expression level in gastrocnemius muscle of aged mice, suggesting a decreasing trend with increasing age (Figure 4a, b). Real-time quantitative PCR (qRT-PCR) results also showed that the mRNA expression of PPARα in the gastrocnemius muscle of young, adult and aged mice exhibited a gradually decreasing trend (Figure 4 c).

Overall, the results showed that the expression of PPARα decreased with increasing age.

Figure 4: Western blot assay of expression level of PPARα protein. (a) PPARα and GADPH bands. (b) Relative expression of PPARα by Western blot (n=3; **P<0.01). (c) Real-time quantitative PCR of PPARα mRNA expression. (n=7; *P<0.05).

Immunofluorescence assay of PPARα expression in gastrocnemius muscle of mice at different age stages

Immunofluorescence assay showed that PPARα was expressed in both the cytoplasm and the nucleus of gastrocnemius tissue sections. There were more positive areas in the gastrocnemius muscle of young mice than that of adult mice, with the least positive areas in aged mice, further confirming that PPARα expression level was decreased with increasing age (Figure 5).

Figure 5: Immunofluorescence assay of PPARα in gastrocnemius muscle of mice at different age stages. DAPI (blue) shows nuclei. Scale bar=100 μm.

Skeletal muscle is one of the largest tissues in the body, accounting for about 40% of the total body weight. In addition to supporting movement, it also plays an important role in regulating energy metabolism in the body. However, many factors including age, muscle fiber types, exercise and diet habits can affect the quality and function of skeletal muscles. Through HE staining, we confirmed that the morphology of the gastrocnemius muscle in mice of different ages was very different and the morphology of the gastrocnemius muscle in young mice was more closely arranged and had a larger crosssectional area than in older mice. This is a common morphological difference in skeletal muscle between young and aged animals.

PPARα is a transcription factor modulating the expression of genes responsible for fatty acid transport and oxidation and it is widely present in animal skeletal muscles. We confirmed the expression of PPARα in mouse gastrocnemius muscle by PCR. One previous study has indicated that PPARα expression in skeletal muscles significantly increases after aerobic exercise. PPARα has been reported to affect the expression of inflammation-related cytokines in skeletal muscle and the expression of PPARα in the myocardium, liver, and skeletal muscles of aged mice is much lower than that of young mice. Similarly, we measured the expression of PPARα in the gastrocnemius muscle of mice among different ages at the protein and mRNA level, than we found that the expression of PPARα in the gastrocnemius muscle of aged mice was significantly lower than that in young mice. These existing research suggests that PPARα may have a certain effect on the quality of skeletal muscle.

Fasting has been reported to affect the expression of PPARα in the liver and skeletal muscles and its downstream FGF21 in the liver has been found to affect skeletal muscles atrophy under fasting conditions. Usually, age and diet habits have effect on skeletal muscle mass, and thus we investigated the change of PPARα expression in skeletal muscle with age. In this study, we found that the expression levels of aging markers P21 and P53 were increased with increasing age, therefore, this indicated the age difference in mice. But the expression of PPARα in the skeletal muscle of mice was decreased with increasing age and the higher expression of PPARα in the skeletal muscle of young mice than that of aged mice indicated that PPARα had an impact on skeletal muscle development.

In summary, PPARα was expressed in the gastrocnemius muscle of mice at different age stages, exhibiting significant differences in expression levels among different ages of mice. Expression of PPARα was the highest in young mice and the lowest in aged mice. PPARα was expressed in both the cytoplasm and the nucleus. Our findings lay a foundation for further research on PPARα and understanding its relationship with skeletal muscle development.

This study was approved by the Animal Experimentation Ethics Committee of Shanxi Agricultural University, Taigu, China and all procedures involving animal treatment and sample collection were performed by veterinarians following the Guiding Principles for animal use described by the Council for International Organizations of Medical Sciences (CIOMS).

The authors declare that they have no competing interests

This project was supported by the National Natural Science Foundation of China (No. 32102634), the Fundamental Research Program of Shanxi Province (No. 20210302124700, 202303021211092, 202103021223166), Shanxi Province Excellent Doctoral Work Award-Scientific Research Project (No. SXBYKY2021043, SXBYKY2022013, SXBYKY2022039), Start-up Fund for doctoral research, Shanxi Agricultural University (No. 2021BQ08, 2021BQ69) Shanxi Provincial Graduate Education Innovation Project (No. 2023KY345), Shanxi Agricultural University “Outstanding Youth Cultivation Project” (2024YQPYGC02) and the Fund for Shanxi“1331 Project”(20211331-16, 20211331-12). All authors read and approved the final manuscript.

YY and HW: Conceptualization, funding acquisition, project administration. Jiahui Qi: Data curation, methodology, writing-original draft preparation. MZ: Methodology, writing-original draft preparation. HX: Software, validation. XW: Methodology. HW: Date curation. JL: Formal analysis. XL: Data curation. XY: Resources. YY: Writing review and editing.

All animal protocols in this study were approved by Institutional Animal Care and Use Committee of Shanxi Agricultural University. The experiments are conducted in accordance with relevant guidelines and regulations. The study complied with ARRIVE guidelines.

The data are available from the corresponding author on reasonable request.

1. Frontera WR, Ochala J (2015) . Calcif Tissue Int 96: 183-195.

   [] [] []

2. Schiaffino S, Reggiani C (2011) . Physiol Rev. 91: 1447-1531.

   [] [] []

3. Lim JY, Frontera WR (2023) . J Biomech 152: 111559.

   [] [] []

4. Yagai T, Nakamura T (2022) . Front Med 9: 1060244.

   [] [] []

5. Tahri-Joutey M, Andreoletti P, Surapureddi S, Nasser B, Cherkaoui-Malki M, et al. (2021) . Int J Mol Sci 22: 8969.

   [] [] []

6. Wang L, Cai Y, Jian L, Cheung CW, Zhang L, et al. (2021) . Cardiovasc Diabetol 20: 2.

   [] [] []

7. Lamichane S, Dahal Lamichane B, Kwon SM (2018) . Int J Mol Sci 19: 949.

   [] [] []

8. Staels B, Auwerx J (1997) Role of PPAR in the pharmacological regulation of lipoprotein metabolism by fibrates and thiazolidinediones. Curr Pharmaceu Des 3: 1-4.

   []

9. Grabacka M, Pierzchalska M, Dean M, Reiss K (2016) . Int J Mol Sci 17: 2093.

   [] [] []