On-Station and On-Farm Screening of Bread Wheat (Triticum aestivum L.) Genotypes across Selected Potential Areas in Southern Ethiopia
Received: 13-Mar-2020 / Accepted Date: 28-May-2020 / Published Date: 05-Jun-2020 DOI: 10.4172/2329-8863.1000446
Abstract
Wide use of unimproved cultivars and management practices, diseases especially wheat rusts are some of the factors significantly affecting wheat production in Ethiopia. In the present study, 23 elite bread wheat genotypes and two check varieties (Danda’ and Digalu) were evaluated at Hossana, Angacha, Kokate and Waka in 2014 and 2015 for grain yield and responses to stem rust. The study identified two bread wheat genotypes namely ETBW6440 with better mean grain yield ranged from 3636 to 4669 kg/ha and ETBW6188 with mean grain yield ranged from 3740 to 4917 kg/ha. ETBW6440 and ETBW6188 also exhibited 5MR and 20MR to stem rust, respectively. After seed multiplication in 2016, the two genotypes and check varieties Danda ’ and Wane were promoted to Variety Verification Trial (VVT) which was conducted at Hossana, Angacha and Kokate and on two farmers’ fields at the vicinity of each research station using large plots in 2017. The VVT at the three stations and on farmers’ fields were evaluated by national variety releasing committee, group of farmers and group of researchers. During VVT, a bread wheat genotype ETBW6188 exhibited overall better field performance and tolerable level of stem rust reaction across the three research stations and farmers’ fields. Thus, ETBW6188 was preferred by all groups participated in evaluation of VVT and finally decided to release the genotype which was later given a breeder name “Bondena”. Molecular analysis revealed that Bondena contained Sr31 and Sr58 which are supposed to provide all stage resistance and adult plant resistance, respectively to various stem rust races. Therefore, we recommend Bondena for production to highlands of SNNPR where the variety was evaluated including areas with similar agro-ecologies.
Keywords: Bondena; Grain yield; Stem rust resistance; Stem rust resistance genes; Triticum aestivum
Introduction
Bread wheat (Triticum aestivum L.) is one of the most important staple cereal crops grown worldwide. In Ethiopia, wheat is the third major crop in area coverage [1]. In wheat production area, Ethiopia is the leading in sub-Saharan countries [2]. Wheat accounts for 20% of the nation ’ s total cereal production including maize, barley, tef, sorghum and others [2,3].
Wheat production area in the country has been steadily increasing and reached to more than 1.7 million ha [4,5]. The small-scale farms contribute the major proportion against large commercial farms of wheat production where the former accounts for more than 90% of the present production area in Ethiopia [6]. Wheat productivity growth rate appeared to be too retarded and it does not exceed 2.4 tons per hectare until 2017 where it was more than 3.4 tons per hectare of world average in the same year [7]. Although the current government of Ethiopia expected to increase wheat production in the coming years, the nation still couldn’t meet local demand [6]. To narrow the gap between domestic production and domestic demand, the government has been continuously importing wheat from the Black Sea region for the last several years incurring a lot of foreign hard currency [3,6].
Messay et al. reported the mean productivity of the wheat about 0.76 t/ha in SNNPR [8]. However, the productivity has been accelerated up to 2.5 t/ha in 2015/2016 implying more than 30% yield gain [4]. Although the current improvement can be seen as a notable change within 3-4 years, this productivity continued to be grumbled as still low compared to potential productivity being recorded for improved varieties in experimental plots. More than 3.50-5.00 t/ha average productivity are being reported for bread wheat from various Experimental Stations [9].
The current low productivity at national level (Ethiopia) and regional level (SNNPR) are attributed by various production constraints [3,8,10]. Messay et al. reported insufficient choice of wheat varieties in SNNPR [8]. The authors envisaged an increased choice of improved varieties appeared dependent on number and strength of Research Centres in each State of the country. However, before the release of report by Messay et al. SARI, realizing this fact, had been declared for implementation of massive adaptability tests of most of the crop varieties including wheat and other major food crops [8]. Such massive adaptation work has been conducted at several research mandate areas which are at each Research Centre administered by SARI and the approach was targeted to identify best adapted, better yielding and farmer preferred varieties. Scaling up programmes that were conducted after adaptability studies believed to contribute to the present regional average, 2.50 t/ha [11]. Recently, beside adaptability tests, variety development scheme has also laid to develop new wheat varieties for the region. Thus, the present study was initiated with the following objectives:
• To identify wheat genotypes combining better yield and diseases resistance under potential areas and select candidate varieties to promote to VVT.
• To verify and validate candidate varieties before release.
Materials and Methods
Description of the study areas
Hossana is capital city of the Hadya zone; however, the Research Station is located near the city at about 1 km at 7°34’N and 37°50’E at an altitude of 2259 meter above sea level (masl). The mean annual rainfall is 1200-1300 mm and mean annual temperature is 18°C-28°C. The dominant soil type is lixi sols.
Angacha is capital city of the Angacha district in Kemabata Tembaro zone. The Research Station is located near the town at about 0.5 km an altitude of 2400 masl. The mean annual rainfall is 1500-1700 mm and mean annual temperature is 17°C-26°C. The dominant soil type is Alfi sols.
Kokate is part of the Wolayita zone. The Research Station is at about 7 km from Soddo, capital city of Wolyta zone. The site is located at at 6°53’N and 37°48’E at an altitude of 2100 masl. The mean annual rainfall is 1200-1300 mm and mean annual temperature is 18°C-28°C.The dominant soil type is sandy loam.
Waka is part of the Dauro zone. The Research Station is located at about 9 km from Waka, capital city of Mareka district in Dauro zone. The site is located at an altitude of 2430 masl. The mean annual rainfall is 1450-1630 mm and mean annual temperature is 14 °C-25°C. The dominant soil type is sandy loam.
Crop production systems are nearly similar at each Research Station. Enset and potato are some of the major root crops grown in the vicinities of the stations. Bread wheat is one of the major cereals grown at each location.
Experimental materials
Hundreds of bread wheat genotypes developed for potential areas were procured from Centro Internacional de Mejoramiento de Maiz y Trigo (CIMMYT), Mexico to Ethiopia; and we received 120 genotypes from Kulumsa Agricultural Research Center to be tested under observation nursery that was conducted at Kokate in 2013. For the present study, in total, 23 bread wheat genotypes (out of the 120) were promoted to regional variety trial (RVT) based up on better grain yield and low level of infection against different wheat diseases. Including two standard checks, Danda’ and Digalu, 25 wheat materials were evaluated at RVT level at four Research Stations: Hossana, Angacha, Kokate and Waka in 2014 and 2015. After two years of evaluation, two bread wheat genotypes, ETBW6440 and ETBW6188, were further promoted to VVT based up on best mean grain yield and better reaction to stem rust. The main crop season of 2016 was used to multiply seed for the two bread wheat genotypes. Bread wheat genotypes, ETBW6440 and ETBW6188, and check varieties, Danda’ and Wane, were evaluated at VVT level at Hossana, Angacha and Waka Research Stations and two farmer fields in vicinities of each station in 2017.
Seed rate of 100 kg/ha was used during both experiments: RVT and VVT. A plot size of 2.5 m by 1.2 m was used for row planting spaced by 20 cm during RVT. During VVT, a high plot size, 10 m by 10 m, was used with similar planting types and row spacing. Fertilizers DAP and urea were used at rates of 100 kg/ha, respectively during RVT. However, NPS and urea were used at rates of 120 and 100 kg/ha, respectively during VVT. During both RVT and VVT, urea was applied in split (one-third during planting and two-third 35-40 days after planting). Weeds were managed by hand weeding uniformly whenever occurred.
Data collection and analysis
During RVT, a plot consisted of six rows of 2.5 m long spaced by 20 cm. Only four central rows were considered for data collection. Grain yield was recorded for the harvests obtained from the four central rows. Pgt, since it was the only prevalent disease during experiments, was recorded based up on protocol developed by Roelfs et al. [12]. Grain yield data from RVT were analysed using SAS software. Homogeneity of error variance was tested taking into account the largest error mean square and the smallest error mean square. Bread wheat genotypes ETBW6440 and ETBW6188 including check varieties Danada ’ and Wane were evaluated at VVT level for general field performance by various groups including NVRC, farmers and researchers. This field evaluation resulted in decision to release ETBW6188 latter named “Bondena”.
DNA for newly released variety, Bondena, was extracted in molecular lab of the University of the Free State (UFS), South Africa according to protocol described by Saghai-Maroof et al. [13]. SSR markers linked to selected Sr genes were compiled and checked for their tight linkage. Those markers validated for their tight linkage were used to assay presence of selected Sr genes in a bread wheat variety Bondena and the markers were rated as present (1) or absent (0) (Table 1).
| Targeted gene | Marker | Forward primer (5’.3’) | Reverse primer (5’.3’) | References |
|---|---|---|---|---|
| Sr2 | csSr2 | CAAGGGTTGCTAGGATTGGAAAAC | AGATAACTCTTATGATCTTACATTTTTCTG | [14] |
| Sr31 | Iag95 | CTGTGGATAGTTACTTGATCGA | CCTAGAACATGCATGGCTGTTACA | [15] |
| Sr42 | FSD-RSA | GTT TTA TCT TTT TAT TTC' | CTCCTCCCCCCA | [16] |
| Sr55 | Gwm 192 | GGTTTTCTTTCAGATTGCGC | CGTTGTCTAATCTTGCCTTGC | [17,18] |
| Sr57 | CSSfr5 | GGGAGCATTATTTTTTTCCATCATG | ACTTTCCTGAAAATAATACAAGCA | [19] |
| Sr58 | Barc 80 | GCGAATTAGCATCTGCATCTGTTTGAG | CGGTCAACCAACTACTGCACAAC | [20] |
| SrTmp | Gpw5182 | TCCACTTCACTAACAAACACGG | AAAAGCTGTATAGGCAGTTCGC | [16] |
Table 1: Simple sequence repeat markers linked to stem rust resistance genes used in thepresent study.
Results
ANOVA using SAS software v 9.0 revealed significant differences (P<0.05) among bread wheat genotypes for mean grain yield at each Research Station, except for Kokate. Moreover, the analysis revealed significant differences among the wheat genotypes for overall mean obtained across years and locations (Table 2). All genotypes and check varieties performed well at Angacha with mean yield ranged from 3694 kg/ha for a genotype ETBW6649 to 4917 kg/ha for a genotype ETBW6188. At this Research Station, both check varieties Danda’ and Digalu gave better mean grain yield of 4453 and 4623 kg/ha, respectively. High mean grain yield (across genotypes and years), 4454 kg/ha, was also obtained at Angacha followed by 3137, 2947 and 2532 kg/ha at Kokate, Hossana and Waka, respectively.
| No | Bread wheat varieties | Average grain yield (kg/ha) | ||||
|---|---|---|---|---|---|---|
| Angacha | Hossana | Waka | Kokate | Average grain yield combined over environments | ||
| 1 | ETBW6432 | 4073bac | 3108edfc | 2008f | 2997 | 3047ef |
| 2 | ETBW6434 | 4902a | 3179ebdc | 2753ebdcf | 3501 | 3584bac |
| 3 | ETBW6435 | 4672ba | 2930edf | 2625ebdcf | 3206 | 3358edc |
| 4 | ETBW6440 | 4669ba | 3661a | 2945bdac | 3266 | 3636ab |
| 5 | ETBW6481 | 4555ba | 2658ef | 2248egcf | 3348 | 3203ed |
| 6 | ETBW6482 | 4860ba | 3189ebdc | 2948bdac | 3190 | 3547bdac |
| 7 | ETBW6490 | 4460bac | 2924edf | 3015bac | 3182 | 3397ebdc |
| 8 | ETBW6544 | 4686ba | 3274bdc | 3120ba | 3417 | 3625ab |
| 9 | ETBW6120 | 4461bac | 2717edf | 2229egcf | 3114 | 3131e |
| 10 | ETBW6166 | 4501ba | 3034edfc | 2267egcf | 3143 | 3236edc |
| 11 | ETBW6184 | 4213bac | 2561f | 2715ebdcf | 3376 | 3217edc |
| 12 | ETBW6185 | 4422bac | 2638ef | 2542ebdcf | 3087 | 3173e |
| 13 | ETBW6133 | 4257bac | 2559f | 2396ebdgf | 2949 | 3041ef |
| 14 | ETBW6188 | 4917a | 3533bac | 3374a | 3125 | 3740a |
| 15 | ETBW6189 | 4371bac | 2912edf | 2183gf | 2801 | 3067ef |
| 16 | ETBW6196 | 4289 | 2812edf | 2371edcf | 2700 | 3043ef |
| 17 | ETBW6337 | 4619ba | 2996edfc | 2407ebdgf | 3120 | 3266edc |
| 18 | ETBW6339 | 4129bac | 2619ef | 2523ebdgf | 3069 | 3085e |
| 19 | ETBW6262 | 4282bac | 3019edfc | 2641ebdcf | 2949 | 3223edc |
| 20 | ETBW6454 | 4489ba | 2536f | 2083gf | 3147 | 3064ef |
| 21 | ETBW6497 | 4567ba | 3684a | 2231egcf | 3181 | 3416ebdc |
| 22 | ETBW6533 | 4356bac | 2956edfc | 2829ebdc | 3496 | 3410ebdc |
| 23 | ETBW6649 | 3694 | 2568f | 1733g | 2921 | 2729f |
| 24 | Danda’a | 4453bac | 2674ef | 2593ebdcf | 2992 | 3178e |
| 25 | Digelu | 4623ba | 2804edf | 2487ebdgf | 3103 | 3193e |
| Mean | 4454 | 2947 | 2532 | 3137 | 3268 | |
| CV | 14.6 | 16.9 | 16.4 | 19.8 | 20.3 | |
Table 2: Mean grain yield (kg/ha) in each and over locations in bread wheat genotypes evaluated across four locations in 2014 and 2015.
Considering overall mean grain yield for each genotype across locations and years (across eight environments), the means ranged from 2729 for ETBW6649 to 3740 for ETBW6188. For the same type of means, six genotypes namely ETBW6434, ETBW6440, ETBW6482, ETBW6544, ETBW6188 and ETBW6497 significantly out yielded all other genotypes and check varieties with their overall mean grain yield of 3584, 3636, 3547, 3625, 3740 and 3416 kg/ha, respectively. However, no significant difference was realized among those six wheat genotypes.
Assessment for reaction to wheat Pgt revealed variable disease severity (DS) ranged from 5% for ETBW6440 to 80% for Danda’ and variable field responses such as MR (moderately resistant), MS (moderately susceptible) and S (susceptible) including their combined forms such as MRMS, MSS and SMS. None of the genotypes exhibited overall R (resistance). Most of the genotypes exhibited S accompanied by DS more than 20% (Table 3).
Six bread wheat genotypes, which gave highest overall mean grain yield and listed earlier also showed variability in DS and field responses. Overall DS and field responses of 30S, 5MR, 40S, 40S, 20MR and 20MS were recorded for ETBW6434, ETBW6440, ETBW6482, ETBW6544, ETBW6188 and ETBW6497, respectively (Table 3). Therefore, the study revealed that genotypes ETBW6440 and ETBW6188 with their better overall mean grain yield and disease reaction 5MR and 20MR, respectively, combined better overall mean grain yield and resistance to Pgt. These both bread wheat genotypes thus were promoted to VVT. However, at the end of VVT, the latter genotype, ETBW6188, was decided to be released by NVRC and it was given commercial name “Bondena”.
| No. | Angacha | Hossana | Waka | Kokate | Overall scorea | ||||
|---|---|---|---|---|---|---|---|---|---|
| 2014 | 2015 | 2014 | 2015 | 2014 | 2015 | 2014 | 2015 | ||
| 1 | 10S | 200S | 30S | TrMR | 30S | 10MS | 10S | 55S | 55S |
| 2 | 5S | 255S | 20S | TrMS | 30S | 10MS | 5MS | 5MS | 30S |
| 3 | 25SMS | 25MS | 10MS | 10SMS | 30MSS | 5S | TrS | 10SMS | 30MSS |
| 4 | TrR | 0 | 5MR | 0 | 5MR | TrR | TrR | TrMR | 5MR |
| 5 | 10MS | 10MS | 50S | 0 | 40SMS | 5S | 10MS | 10MS | 50S |
| 6 | 10S | 10S | 40S | 0 | 40S | 5SMS | 10SMS | TrRS | 40S |
| 7 | 15S | 25S | 20SMS | 0 | 20SMS | 45S | 5SMS | 10SMS | 45S |
| 8 | 5S | 40S | 20MSMR | TrS | 20MSMR | 40S | 10MS | 40SMS | 40S |
| 9 | 20S | 20S | 10SMS | TrR | 10MS | 55S | 20MS | 20SMS | 55S |
| 10 | 25S | 45S | 5MS | 0 | 5MS | 35S | 50S | TrS | 50S |
| 11 | 5S | 5S | 30S | TR | 5MS | 25S | 5MS | TrS | 30S |
| 12 | 20S | 25S | 5SMS | TrMS | 5SMS | 25S | 10S | TrMS | 25S |
| 13 | 5S | 15S | 10SMS | 30S | 10SMS | 10SMS | 25SMS | TrS | 30S |
| 14 | 5MR | 15MR | TrMR | 0 | TrMR | 10MR | 5RMR | 20MR | 20MR |
| 15 | 10MS | 15MS | 10SMS | 5SMS | 15SMS | 15SMS | 5MR | 20SMS | 20SMS |
| 16 | 20S | 30S | 25S | 0 | 50S | 15S | 10S | 10MS | 50S |
| 17 | 30S | 40S | 20S | 5MS | 20S | 55S | 5SMS | 30S | 55S |
| 18 | 20S | 40S | 25S | 15S | 10SMS | 60S | 10SMS | 25SMS | 60S |
| 19 | 10MS | 20MS | 5MS | 55S | 5MS | 35SMS | 25SMS | 45S | 55S |
| 20 | 20S | 20S | 20S | TRS | 20MS | 20SMS | 50S | 45S | 50S |
| 21 | TrMS | TrMS | TrMR | 10MS | TrMSMR | 20MS | TrMR | 5MS | 20MS |
| 22 | TrMS | TrMS | TrMS | 10MS | 25S | 30SMS | TrS | 40S | 40S |
| 23 | TrMS | TrMS | 20MRMS | 10MR | 20MR | 10MR | TrR | 10MR | 20MRMS |
| 24 | 5MR | 35SMS | 10RMR | 25SMS | 20MS | 80S | 10MR | 40S | 80S |
| 25 | 5MR | 30MS | 5MRR | 40MS | 30MSS | 60S | 10MS | 50S | 60S |
Note: Tr=trace, DS is below 5; aoverall score is the highest score (but not mean) across eight environments.
Table 3: Stem rust score in each season and location in elite wheat genotypes evaluated at four locations in 2014 and 2015.
DNA from newly released variety, Bondena, was extracted. All available DNA markers reported in previous studies to be linked to known Sr genes such as Sr2, Sr25, Sr31, Sr42, Sr55, Sr57, Sr58 and SrTmp were assembled and few were validated for their tight linkage (Table 1). Analysis of SSR markers linked to the Sr genes in a bread wheat variety Bondena revealed that the variety was positive for the most important ASR gene, Sr31 and APR gene, Sr58.
Discussion
Bread wheat, one of the most important staple food crops, has been used as a source of various traditional and modern food products in Ethiopia and other sub-Saharan countries [2,5]. Although majority of its production lays mainly on small scale farming in Ethiopia, the wheat has considered as a commodity crop which has been used as a source of employment and income generation for youths and women [14]. It is a crop of mainly mid to highlands of the country where the areas are characterized by fragmented wheat lands shared among many millions of households. In such cases it is essential to intensify the farming system to achieve more yields per unity area of land. The present average wheat productivity is too low, 2.50 t/ha, at national level in Ethiopia [4]. The same source reported similar average in the case of SNNPR. Low average productivity, lower than 20 t/ha, was also reported in some zones under SNNPR. Such and similar situations were used as drivers at the back for initiation of the present study to evaluate different bread wheat genotypes across various locations and years. Number of bread wheat genotypes, in the present study, exhibited higher grain yields as high as nearly two folds of the current average productivity reported in previous studies at national (Ethiopia) and regional (SNNPR) levels [4]. To improve wheat productivity, existing natural and artificial variability within a crop need to be assessed [15]. Results from the present study revealed the potential and possibility of increasing wheat productivity through varietal and seed replacement. Significance of varietal and seed replacement for yield increment at farm level was also detailed in the report released by Mathewos and Yasin [11]. However, modern variety alone cannot bring substantial yield gain with no combination of improved management practices [20-23]. Besides attempts for improvement of genetics of a cultivar, there is always a need to pinpoint other agronomic aspects where they intercept with better yield gain in a particular cultivar [23]. High yields in superior wheat genotypes identified in the current study were accompanied with application of all other improved agronomic practices such as recommended seed rate, fertilizer types and rates, weed management, etc. Although yield gain due to variety and due to improved management practices were not clearly quantified, variability observed in productivity among test lines was due to wheat genotypes with no doubt. It was because of that all genotypes were compared at similar management practices across locations and years.
From over locations and years evaluation of the wheat genotypes, six bread wheat genotypes significantly outshined all other genotypes and check varieties for grain yield. They gave relatively higher overall mean yields in a suggested improved management practice. Nonetheless, the current study did not recommend advancement of all six genotypes as they exhibited variability to disease resistance. However, only two of the genotypes (out of the six), ETBW6440 and ETBW6188, were promoted to VVT, next phase of the evaluation because these two genotypes exhibited low field infection due to Pgt. VVT is usually considered as a phase of validation where the candidate varieties including checks are often evaluated at both stations and on farms. The VVT experiments were subjected to various groups including NVRC, researchers and farmers to gather their views in order to judge whether the candidate variety qualifies to be a VARIETY for production or not. To-date, more than 100 bread and durum wheat varieties were released in Ethiopia [9]. Most of the varieties were out of production mainly due to susceptibility to ever evolving races of wheat rusts [5,24]. Diseases are the other major wheat production constraints in Ethiopia and worldwide. Most of the varieties affirmed previously for high yields have been suffered from disease outbreaks and got rid of from the production. Disease epidemics occurred in the past on major Ethiopian wheat varieties such as Dshen in 1988, Enkoy in 1993 and 1994, Galema in 2010, Digalu in 2013 and most recently Hidase in 2018 (unpublished; personal observation) has caused heavy damages on the crop [3,25-28]. The past history on effects of disease epidemics to various wheat varieties indicates importance of ongoing searches in order to develop varieties combining both disease resistance and better grain yield. Thus, timely availing of new varietal choices ahead of evolvement of new disease epidemics always appeared essential. In the present study, the newly released bread wheat variety, Bondena, was recommended because of better yield and acceptable resistance to wheat stem rust diseases across all locations and years during NVT and VVT. Better phenotypic expression against stem rust recorded at experimental field, was further confirmed by molecular analysis. All stage resistance gene Sr31 and APR gene Sr58 were detected in this variety. According to reports released by Nirmala et al. and Singh et al. some of the Sr genes including Sr31, which were defeated by race Ug99 (syn. TTKSK), were found resistant to the new non-Ug99 race TKTTF, one of the aggressive Pgt races that was discovered in Ethiopia in 2013 [27-29]. Sr58, an APR gene, was also reported to be efficient to provide resistance against Ug99 and non-Ug99 races [27]. Therefore, the newly released variety, Bondena, can be one of good choices not only for further production, but it can also be used as a source for important disease resistance genes for further gene pyramiding programs.
Conclusions and Recommendations
Currently, wheat yield reduction got special concern by Ethiopian government. Population growth and tendency of Ethiopian people to change lifestyle at both rural and urban population has led to high demands resulted in obligation to import more wheat grain from abroad through incurring a lot of foreign currency which otherwise would be used for other developmental purposes. To narrow or close difference between local demand and local supply, appropriate strategies need to be put in a place. System intensification in cases of small-scale farmers and exploitation of unused land resource in lowlands through laying irrigation schemes has hopped to raise local production to the level of current demand. To raise wheat productivity in already existing lands, development of better yielding varieties combining resistance to diseases is the priority agenda in wheat improvement research in developing and developed countries. The present study delivered a new bread wheat variety, Bondena which gave better yield across eight environments and finally judged during VVT to be released by various groups composed of NVRC, farmers and researchers. Apart from due to other uncontrolled disasters such as outbreak of diseases, droughts and/or other calamities, it must be cautioned that the current productivity in any new varieties can be affected negatively for any deviation in application of improved management practices. Therefore, we recommend bread wheat variety Bondena with improved management practices for wider production in highlands of SNNPR.
Acknowledgement
The authors acknowledge the Southern Agricultural Research Institute [SARI] for funding the research. The authors would also like to thank University of the Free State, South Africa for allowing molecular lab and providing all lab facilities for analyzing known Sr genes in newly released bread wheat variety.
Conflict of Interest
The authors declare that there is no conflict of interest.
References
- Shiferaw B, Melinda S, Hans-Joachim B, Etienne D, Mathew R, et al. (2012) Crops that feed the world. Past successes and future challenges to the role played by wheat in global food security. Food Secur 5: 291-317.
- Tadesse W, Schmolke M, Hsam SLK, Mohler V, Wenzel G, et al. (2017) Molecular mapping of resistance genes to tan spot (Pyrenophoratritici-repentisrace L) in synthetic wheat lines. Theoret Appli Gene 114: 855-862.
- CSA (Central Statistical Agency) (2016) Crop Production Forecast Sample Survey: Report on Area and Crop Production Forecast for Major Crops (For Private Peasant Holding, Meher Season) Addis Ababa, Ethiopia. pp: 112.
- FAOSTAT (Food and Agriculture Organization of the United Nations) (2017).
- Messay YG, Fekadu D, Terfe F, Sultan U (2012) Prospects and challenges of wheat production in Ethiopia: Evidence from major wheat producing regions of the country.
- MOA (Ministry of Agriculture and Livestock Resource, Plant Variety Release, Protection and Seed Quality Control Directorate) (2017) Crop Variety. Addis Ababa, Ethiopia. 20: 28-56.
- Mago R, Simkova H, Brown-Guedira G, Dreisigacker S, Breen J, et al. (2011) An accurate DNA marker assay for stem rust resistance gene Sr2 in wheat. Theoret Appli Gene 122: 735-744.
- Forrest KL, Pujol V, Bulli P, Pumphrey M, Wellings C, et al. (2014) Development of a SNP marker assay for adult plant resistance gene Lr67 of wheat using genotyping by sequencing approach. Molec Breed 34: 2109-2118.
- Macauley H (2015) Cereal crops: Rice, Maize, Millet, Wheat. Background paper.
- Shiferaw B, Negassa A, Koo J, Sonder K, Braun JA, et al.(2011) Future Wheat Production in sub-Saharan Africa: Analysis of the Expanding Gap between Supply and Demand Profitability of Domestic Production. Paper Presented at Increasing Agricultural Productivity and Enhancing Food Security in Africa. New Challenges and Opportunities 1-3 November 2011, Africa Hall, UNECA, Addis Ababa, Ethiopia.
- Badebo A, Hundie B (2016) Incidence and Challenges of Rusts in Wheat Production. In: Bishaw Z, Dawit A, Abebe A, Abebe K (eds.). Containing the Menace of Wheat Rusts: Institutionalized Interventions and Impacts. EIAR, Addis Ababa. pp: 41-48.
- Shank R (1994) Wheat stem rust and drought effects on bale agricultural production and future prospects. Report on February 17-28 assessment.
- Badebo A (2002) Breeding Bread Wheat with Multiple Disease Resistance and High Yielding for the Ethiopian Highlands: Broadening the Genetic Base of Yellow Rust and Tan Spot Resistance. PhD Thesis.
Citation: Ashamo M, Chumamo M, Said A (2020) On-Station and On-Farm Screening of Bread Wheat (Triticum aestivum L.) Genotypes across Selected Potential Areas in Southern Ethiopia. Adv Crop Sci Tech 8: 446. DOI: 10.4172/2329-8863.1000446
Copyright: © 2020 Ashamo M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Select your language of interest to view the total content in your interested language
Share This Article
Recommended Journals
Open Access Journals
Article Tools
Article Usage
- Total views: 3584
- [From(publication date): 0-2020 - Jul 26, 2026]
- Breakdown by view type
- HTML page views: 2534
- PDF downloads: 1050
