Proteus and Serratia Strains Obtained from Oil-Polluted Water Hydrocarbon Biodegradation
Received: 02-Jan-2023 / Manuscript No. ogr-22-86637 / Editor assigned: 04-Jan-2023 / PreQC No. ogr-22-86637(PQ) / Reviewed: 18-Jan-2023 / QC No. ogr-22-86637 / Revised: 23-Jan-2023 / Manuscript No. ogr-22-86637 (R) / Published Date: 27-Jan-2023 DOI: 10.4172/2472-0518.1000283
Abstract
Two indigenous hydrocarbon exercising bacteria strains, designated as TKZ and QGR were insulated in oil painting rich Niger Delta of Nigeria. Determination of the nucleotide sequence of the gene garbling 16S rRNA allowed TKZ and QGR to be linked as Proteus vulgaris and Serratia marcescens. Hydrocarbon declination eventuality of the strains was verified on hydrocarbon mineral mariners medium (1, v/ v) at 37 °C. Assessment of oil painting declination capability of the isolates was covered using gas chromatographic analysis (GC). The capability of the strains to use benzene, diesel, kerosene, and naphthalene was also studied. The results show minimal increase in optic consistence at 540 nm and total feasible counts was commensurable with drop in pH of the culture media. Chance declination in the culture medium showed that the two isolates displayed biodegradation effectiveness above 90 for kerosene [1]. The two bacterial strains also retain a plasmid of about9.1 kb size which is suspected to impact the bacterium’s hydrocarbon declination eventuality.
Keywords
Hydrocarbon; Proteus vulgaris; Serratia marcescens; Biodegradation; Nucleotide sequence; Gas chromatography; Niger delta
Introduction
The Nigerian frugality is veritably dependent on oil painting that’s substantially concentrated in the Niger Delta region where product platforms flow stations, channels, shipping, tank granges, loading docks and refineries produce a constant trouble of oil painting spillage. It’s an honored fact that environmental pollution problems associated with oil painting and gas disquisition and product live in the Niger Delta area. The concern over water quality relates not just to the water itself [2], but also to the peril of prolixity of poisonous substances into other ecosystems. There have indeed been reports of oil painting pollution impacts on critical territories similar as the oceanographic ecosystems, which may eventually get into the marine food chain. It’s a known fact that oil painting tumbles are natural consequences of petroleum exploitation and are necessary. The dangerous goods of oil painting tumbles on the terrain are numerous, especially on the original people, who suffer detriment to their health, productivity, inflows, and weal. The injurious goods make it obligatory to have a counter measure for the petroleum hydrocarbon contaminant in the terrain. Although the microbiological option has been preferred as the most environmentally friendly option [3], the operations of genetically finagled and enhanced microbes for bioremediation have also been developed and considered. It has been suggested thus, that indigenous microorganisms insulated from defiled spots will help in the prostrating of these problems since microorganisms are suitable to degrade the ingredients as well as having advanced forbearance and toxin that may annihilate those introduced outside species. Biological declination of petroleum hydrocarbon adulterants and petrochemicals by locally insulated bacteria strains have been considerably delved in Nigeria. This paper examines the biodegradation of Bonny light crude oil painting, benzene, diesel, kerosene, and naphthalene by two indigenous bacterial species insulated in oil painting rich Niger Delta [4].
Insulation and Characterization of Bacterial Strains
Two indigenous hydrocarbon exercising bacteria strains, designated as TKZ and QGR were insulated from the water sample collected near an oohing oil painting well in the Niger Delta region. These bacteria are small, gram-negative rods and are facultative anaerobes. The strains were linked from their morphological, biochemical, enzymatic characteristics and through the use of molecular ways (16S Ribosomal rRNA sequencing). The biochemical and enzymatic characterization were performed using Crystal Enteric/Non-Fermenter ID tackle (Crystal E/ NF)( Becton Dickinson, Cockeysville, USA) according to the manufacturer’s protocol. The strains were saved at –70°C in nutrient agar containing 10-glycerol and regenerated doubly before use in the manipulations. Strains were characterized according to their morphological, physiological, and biochemical parcels as well as partial 16S rRNA gene sequences and webbing for the presence of plasmid DNA [5].
16S Ribosomal rRNA sequencing
Total genomic DNA was uprooted from overnight LB societies using the marketable tackle Wizard Promega PCR Preps insulation tackle was used to carry out the direct sanctification of DNA from PCR responses yielding a single modification product. The tackle is grounded on DNA list to an ionic exchange resin, followed by resin list to a column, column washing, and posterior DNA elution which is reduced by ionic strength conditions. The performing attention of the genomic DNA template was measured with a nano gram at DNA- 50. The manuals used to amplify the small subunit 16S rRNA gene of the insulate were 5 ′ AGAGTTTGATCCTGGCTCAG3 ′ forward and 5 ′ TACGGCTACCTTGTTACGACTT3 ′ reverse manuals (Sigma Genosys Israel). Genomic DNA of the insulate was also subordinated to PCR modification responses. The roughly1.5- kb amplified PCR product was purified with the Promega PCR sanctification tackle and sequenced [6]. Sequencing PCR was performed in a final volume of 2μl 16S-rear manual, at the Gene sequencing center of the Tel- Aviv University (Israel), and the result attained was compared with sequences in the Gen Bank using the BLAST bioinformatics tool [7].
Plasmid DNA Discovery
The presence of plasmid DNA in the isolates was estimated in agreement with the description of system and anatomized by1.0 agarose gel electrophoresis in TAE buffer pH 8.5 for 30 min. Lambda Hind III DNA molecular mass marker (23130 – 564 bp) was used as a standard for molecular mass determination. The gel was stained with ethidium platitude (0.5 mg/ ml) and observed under UV trans- illuminator for the presence of plasmid band [8].
Restriction Analysis of Insulated Plasmid DNA
Plasmids insulated from QGR and TKZ were digested with three restriction enzymes (BamHIandECOR1, Hind III) at the same time. Aliquots of QGR and TKZ plasmid DNA, prepared were digested an hour at 37°C with ten units of colorful restriction enzymes and the fractions therefore generated were fractionated by electrophoresis on 1.0 agarose gel as described over. The bands, which were imaged under ultraviolet light, were compared with standard marker. Chemical Reagent and Hydrocarbon Substrate Bonny Light Crude was attained from the Bonny Terminal of the Shell Petroleum Development Company of Nigeria, and Benzene and Naphthalene from the experimental lab, Department of Microbiology, Obafemi Awolowo University Ile-lfe, Nigeria. Kerosene and Diesel were attained from the gas stations of the Nigerian National Petroleum Corporation, (NNPC). All the reagents used for the analysis were of logical grade and were attained from BDH Chemicals Limited Poole England except else stated [9].
Presence of Crude Oil Painting Bio-derivative Capacities in Water Samples
The capability of the indigenous bacteria presents in the water samples to degrade Bonny light crude oil painting was tested by introducing the oil painting into fresh unsterilized water sample from the slice zones at 1, (v/ v). The steins (250 ml) were incubated and continuously shaken at 200 rpm at 37 ± 2°C. Bacterial growth was covered by feasible counts on nutrient agar plates, the residual oil painting was measured and the qualitative changes in the hydrocarbon profile of the oil painting were covered by gas–liquid chromatography as preliminarily described [10].
Growth Angles of the Two Bacteria Isolates in Hydrocarbon Medium (Crude Oil Painting)
The system of was used to probe the capability of isolates to use Bonny light crude oil painting. A 50 ml of the weakened water sample was distributed into conical beaker containing minimum medium and 1 of hydrocarbon substrate was aseptically added. The steins were castrated and invested with 2x105 cells/ ml pure societies of the bacteria species. The steins were incubated at 37°C on a rotary shaker (Lab-line No 3590), with nonstop shaking at 120 rpm for a week alongside that of sterile control. Hydrocarbon declination was covered by measuring the turbidity of the culture beaker medium at wavelength 540 nm using NOVASPEC II, Pharmacia Biotech spectrophotometer. The pH and total feasible counts (TVC) of the culture were determined at time intervals as biodegradation indicators [11].
Biodegradation of Specific Hydrocarbons by Bacterial Isolates The extent of benzene, diesel, kerosene, and naphthalene declination were determined by gravimetric analysis. 50 ml of cooled castrated mineral mariners medium was allocated into several castrated 100 ml conical steins and0.5 ml of each castrated hydrocarbon added to make the usual 1 w/ v oil painting. To each of the steins, a pure and distinct culture of insulate formerly grown in nutrient broth and formalized to constant mass was added at1.0 ml of culture to a beaker to maintain uniformity as much as possible. The steins were incubated on rotatory shaker working at 120 rpm for a week at room temperature. After incubation, the steins were subordinated to farther procedures as described below [12].
Birth and Quantification of Residual Oil Painting
The residual oil painting retained on the sludge paper was uprooted with 5.0 ml volume of dichloromethane (CH2Cl2). The remaining contents in the beaker were farther uprooted in 5.0 ml of dichloromethane and also transferred onto the sludge paper. Combined filtrates of both lines were collected in a clean, dry, and preweighed grease free glass vial; the oil painting – detergent admixture was faded to a constant mass on a hot plate at 80°C. The volume of the undegraded residue was calculated as a chance (in grams) of the quantum of oil painting recovered from the sterile inoculated control, taken as 100 [13].
Conclusion
The resistance to digestion by endonucleases has been suggested to be an important survival medium of bacteria against certain stresses situations. An analogous report also confirms plasmids that were resistant to digestion by Ecor R1, Pst-I and PVu-II [14]. In conclusion, this study has shown the complete loss of biodegradation exertion after plasmid curing over emphasizes the part of plasmids in catabolic exertion of hydrocarbon biodegradation. There’s need to sustain the use of natural remittal of weakened terrain in all its ramifications because it’ll reduce chemical deposit in the terrain and ameliorate climate sustainability. The knowledge of the eventuality of these isolates to degrade hydrocarbons is bound to increase possibilities of developing more active microbial strains that could be of applicability in bioremediation of petroleum defiled surroundings.
References
- Ainon H, Chia-Wei P, Nur Faizah AB, Kok-Kee W (2013) . Biorem J 17: 1-10.
- Ayala-del-Río HL, Callister S, Criddle C, Tiedje J (2004) . Appl Environ Microbiol 70: 4950-4960.
- Asemoloye MD, Ahmad R, Jonathan SG (2017) . Chemosphere 187: 1-10.
- Bach QD, Kim SJ, Choi SC, Oh YS (2005) . J Microbiol 43: 319.
- Bezuidenhout CC, Mthembu CC, Puckree T, Lin J (2002) . Water SA 28: 281-286.
- Daccò C, Nicola L, Temporiti MEE, Mannucci B, Corana F, et al. (2020) . Appl Sci 10: 3152.
- Devereux R, Sizemore RK (1982) . Mar Poll Bull 13: 198-202.
- Ekpo MA, Ekpo MI (2006) . Nig J Microbiol 20: 32-859.
- Emtiazi G, Shakarami H (2004) . Afr J Biotechnol 4: 172-176.
- Gaurav P, Deviram G, Urvashi A, Gyana RP, Thangavel M, et al. (2021) . J Hazardous Materials 405.
- Ilori MON, Amund DL (2000) . Z Naturforsch 55: 890-897.
- Kado CI, Liu ST (1981) . J Bacteriol 145: 1365-1373.
- Wang M, Dewil R, Maniatis K, Wheeldon J, Tan T, et al. (2019) . Prog Energy Combust Sci 74 31-49.
- Drünert S, Neuling U, Zitscher T, Kaltschmitt M (2020) . Appl Energy 277: 115578.
, ,
, ,
, ,
,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
Citation: Narkhede B (2023) Proteus and Serratia Strains Obtained from Oil-Polluted Water Hydrocarbon Biodegradation. Oil Gas Res 9: 283. DOI: 10.4172/2472-0518.1000283
Copyright: © 2023 Narkhede B. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Select your language of interest to view the total content in your interested language
Share This Article
Recommended Journals
Open Access Journals
Article Tools
Article Usage
- Total views: 3597
- [From(publication date): 0-2023 - May 24, 2026]
- Breakdown by view type
- HTML page views: 3040
- PDF downloads: 557
