The BRAF, NRAS Mutations and Clinic-pathological features of Thyroid Tumors in Mongolia
Received: 01-Mar-2023 / Manuscript No. jcd-23-89422 / Editor assigned: 04-Mar-2023 / PreQC No. jcd-23-89422 / Reviewed: 18-Mar-2023 / QC No. jcd-23-89422 / Revised: 22-Mar-2023 / Manuscript No. jcd-23-89422 / Published Date: 29-Mar-2023
Abstract
Objective: In this study, we aimed to study BRAFV600E and NRAS mutations among thyroid tumor patients in the Mongolian population.
Methods: Immunohistochemical staining was performed using CD56 antibodies on 59 formalin-fixed paraffinembedded (FFPE) tissue sections. DNA extractions from FFPE and fresh thyroid tumor tissues were extracted using a genomic DNA kit. An ABI 3730xl genetic analyzer was used for DNA sequencing.
Results: The thyroid tumors of 59 patients were studied. These patients were predominantly female (53, 89.8%), and the mean age was 45.61±14.2 years (range 13–72 years). Of these cases, 46 (78%), 3 (5.1%), and 8 (13.61%) were diagnosed as PTC, FTC, and follicular adenoma, respectively, by histology. Immunohistochemistry analysis found that CD56 was expressed in 7 (87.5%) benign tumors and 14 (27.5%) malignant tumors, and the difference was significant (p=0.002). In cases of PTC, the BRAFV600E mutation was positive in 9 (19.6%) cases, while the NRAS mutation was positive in 2 (3.38%) cases. However, the manifestations of these mutations are not significantly associated with the clinic pathological features of PTC.
Conclusion: BRAFV600E and NRAS mutations occurred at a relatively low rate and were not correlated with increased PTC aggressiveness in our study.
Keywords
BRAFV600E; NRAS; Mutation; Thyroid papillary carcinoma; Follicular adenoma; Clinic pathological features; Thyroid tumors
Introduction
Thyroid cancer is the most common endocrine malignancy and presents in 5–30% of total thyroid nodule. It can be classified into papillary thyroid carcinoma (PTC), follicular thyroid carcinoma (FTC), medullary thyroid carcinoma (MTC), and poorly differentiated, undifferentiated or anaplastic carcinoma. The great majority of thyroid cancers are PTC, representing approximately 65–85% of total thyroid cancers. Recently, the incidence of thyroid tumors has gradually increased in Mongolia, doubling in the last 10 years [1-4].
Several genetic mutations have been detected in thyroid tumors, among which BRAF and RAS mutations are well known. BRAF mutations occur in approximately 8% of all types of cancers, with a high mutation frequency in malignant melanoma (50–70%), classic PTC (40–70%), colorectal cancer (CRC, 5–15%), ovarian cancer and hairy cell leukemia (5–100%). The c.1799T>A mutation results in a valine-to-glutamate substitution (p.V600E) at amino acid position 600. This prevalent mutation accounts for over 80% of all BRAF mutations and almost every mutation in thyroid tumors [5-9].
The RAS mutation is found in 10 to 20% of PTCs, but this mutation is slightly more common in follicular neoplasms, including follicular carcinoma (40–50%) and follicular adenoma (20–40%). Identifying these mutations is important for choosing a suitable type of treatment, predicting disease prognosis, and providing detailed diagnostic information. However, no studies have been performed to assess the frequency of BRAF and RAS mutations in thyroid tumors in the Mongolian population [10-13].
CD56 is a neural cell adhesion molecule (NCAM) that mediates homotypic and heterotypic cell-cell adhesion through homophilic binding mechanisms and is widely used in the differential diagnosis of follicular neoplasms. In addition, CD56 is considered a prognostic marker in various cancers, including pancreatic cancer, colon carcinoma and astrocytoma. In cases of thyroid cancers, the expression of CD56 is diminished and correlates with metastatic potential and poor prognosis in some malignant tumors [14].
Therefore, we aimed to study BRAFV600E and NRAS mutations among patients with thyroid tumors and their correlations with histopathological features and CD56 expression related to the prognostic profile in the Mongolian population [15-17].
Materials and Methods
Sample source
We collected 9 fresh thyroid tissue samples and 50 formalin-fixed paraffin-embedded (FFPE) tissue samples from patients who underwent radical surgery at the National Cancer Center (NCC) of Mongolia from 2017 to 2019. All pathologic slides, along with the pathologic reports and clinical records, were reviewed by two expert pathologists [18].
Immunohistochemical staining and evaluation
Staining methods
Immunohistochemical staining was performed using primary antibodies against CD56 (mouse, 123C3.D5, dilution 1:500, Sigma– Aldrich, USA) on FFPE sections. Membranous staining of follicular cells with CD56 was considered positive immunohistochemical staining. The modified Allred scoring system was used to evaluate positivity, with staining intensity and distribution scored separately [19]. The staining intensity was scored as 0 (negative), 1 (weak), 2 (intermediate), or 3 (strong), and the distribution of positively stained cells was semi quantitatively graded as 0 (negative) or 1 (67% positively stained cells). The total staining score was calculated as the sum of these two parameters. Total staining scores from 0 to 2 points were considered negative, while scores from 3 to 8 points were considered positive. To overcome the limitation of this quantification method, we compared the mean staining score as a continuous variable [20-22].
DNA extraction
DNA was extracted from 3–5 sections of FFPE tissues (3–5 microns/section). The sections were deparaffinized by xylene and ethanol treatment and digested with proteinase K at 56 °C overnight. Genomic DNA was extracted using a genomic DNA I kit (TIANamp FFPE DNA kit, Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. DNA extracted from fresh thyroid tumor tissue was extracted using a genomic DNA I kit (Choros Onosh, Ulaanbaatar, Mongolia) as recommended [23].
Polymerase chain reaction (PCR) and sequencing
PCR was performed with primers designed to amplify BRAF exon 15 per Frasca et al. (2008): forward TCATAATGCTTGCTCTGATAGGA and reverse GGCCAAAAATTTAATCAGTGGA.
NRAS exon 3 was evaluated by PCR using primers previously described by Marina et al. (2002): forward 5`- CCT GTT TGT TGG ACA TAC TG -3` and reverse 5`- CCT GTA GAG GTT AAT ATC CG-3`[15]. PCR was performed using standard conditions (95 °C for 5 min, 94 °C for 30 sec, 58 °C for 30 sec, 72 °C for 30 sec, for 40 cycles; 70 °C for 10 min). PCR fragments were analyzed by 2% agarose gel electrophoresis [24].
A DNA cycle sequencing reaction with a total volume of 10 μl was performed on a thermal cycler using 5 μl of Zacdye 2X premix, 1 μl of PCR product (50 ng/ul), 1 μl of primer of 1 μM and 2 μl of water. The PCR conditions were as follows: initial denaturation at 95 °C for 5 min, 30 repetitive cycles of 95 °C/20 sec, 52 °C/30 sec and 60 °C/2 min. Reaction products were purified by sodium acetate and ethanol precipitation, dissolved in formamide DNA solvent (Zanaspex) and loaded into an ABI 3730xl genetic analyzer. Sequencing data were analyzed by Codon Code Alginer ver.9.0.1 software [25-27].
Statistical analysis
Analyses were performed using the IBM SPSS V25.0 program (SPSS Inc., Chicago, USA). Categorical variables were compared using chi-square or Fisher’s exact tests. The Shapiro–Wilks test was used to assess the normality of the distribution of continuous variables. The Mann–Whitney U test was used to evaluate differences in continuous variables between two independent groups. Binary logistic regression analysis was used to assess the independent association of BRAF and NRAS mutations. In these tests, p values were 2-sided, and statistical significance was defined as p < 0.05 [28].
Ethics approval
The institutional review board of the Mongolian National University of Medical Sciences (MNUMS) approved this study (2017.06.09, №17/03-08).
Results
Clinic pathological features
The thyroid tumors of 59 patients were studied. The patients were predominantly female (53, 89.8%), and the mean age was 45.61±14.2 years (range 13–72 years). The histopathological diagnosis of thyroid tumors identified PTC in 46 cases (78%), FTC in 4 (6.8%), follicular adenoma (FA) in 8 (13.61%), and MTC in 1 (1.7%). The median tumor size was 1.5 cm (range 0.25–10.00). Among the 46 PTC cases, 38 (82.6%) were classic, 6 (13%) were follicular variants, 1 (2.2%) was a tall-cell variant, and 1 (2.2%) was an oncocytic variant [29].
Of the 31 (60.8%) patients diagnosed with PTCs at pathologic tumor stages I-II, 20 (64.5%) showed lymphatic vessel invasion, 17 (54.8%) metastasized to regional lymph nodes, and 20 (64.5%) were invasive to the tumor capsule. Of the 15 (32.6%) patients diagnosed with PTCs at pathologic tumor stages III-IV, 13 (86.7%) showed lymphatic vessel invasion, 12 (80%) metastasized to regional lymph nodes, and 11 (73.3%) had extra thyroidal invasion. Generally, the pathologic T stage was associated with extra thyroidal invasion (p=0.02) [30].
CD56 expression in thyroid tumors
CD56 expression was detected by immunohistochemistry in 7 (87.5%) and 14 (27.5%) benign and malignant tumors, respectively (Figure 1). This difference in CD56 expression was statistically significant between tumors of benign and malignant origins (p=0.002). For PTC alone, CD56 was expressed in 12 (26%) and not expressed in 34 (73.9%), including 27 (58.7%) classic and 7 (15.2%) other variants. However, no significant difference in the expression of CD56 was observed between classic and other variants of PTC (p=0.66) [31]. Furthermore, there were no significant differences in other clinic
pathological features, including tumor size, capsular invasion, tumor location, extra thyroid invasion, lymphatic invasion and regional lymph node metastasis, between these 2 groups (CD56 negative vs. positive) (p>0.05) [32].
BRAF V600E and RAS mutations in thyroid tumors
In our study, a total of 10 (16.9%) cases with thyroid tumors were determined to have the BRAFV600E mutation, of which 9 (90%) were diagnosed with PTC, and 1 (10%) was diagnosed with follicular adenoma. All of these mutations were heterozygous (Figure 2). Of the 9 cases with the BRAFV600E mutation, 8 were women, and 5 were older than 45. However, the mutation was not associated with patient age or sex (p>005) [33].
All CD56-positive cases of PTC with the BRAFV600E mutation were classical variants. Of these, 8 (25.8) were more than 1 cm in size, 5 (16.1%) were stage TI-II, 8 (24.2%) had vascular invasion, 8 (24.2%) had lymphatic vessel invasion, and 6 (17.6%) had extra thyroidal invasion. However, there was no statistically significant difference in the presence of the BRAFV600E mutation between the CD56-positive and CD56-negative groups (Table 1) [30].
| Total | BRAF | P value | |||||
|---|---|---|---|---|---|---|---|
| Negative | Positive | ||||||
| N | n (%) | 95% CI | n (%) | 95% CI | |||
| Age group | 0.718 | ||||||
| 45≤ | 22 | 17 (77.3) | 57.1 - 90.8 | 5 (22.7) | 9.2 - 42.9 | ||
| 45> | 24 | 20 (83.3) | 65.1 - 94.1 | 4 (16.7) | 5.9 - 34.9 | ||
| Gender | 0.848 | ||||||
| Female | 40 | 32 (80) | 65.8 - 90.1 | 8 (20) | 9.9 - 34.2 | ||
| Male | 6 | 5 (83.3) | 44.2 - 98.1 | 1 (16.7) | 1.9 - 55.8 | ||
| CD 56 | 0.409 | ||||||
| Negative | 34 | 26 (76.5) | 60.5 - 88.2 | 8 (23.5) | 11.8 - 39.5 | ||
| Positive | 12 | 11 (91.7) | 67.2 - 99.1 | 1 (8.3) | 0.9 - 32.8 | ||
| Tumor size | 0.235 | ||||||
| 1≤ | 15 | 14 (93.3) | 72.8 - 99.3 | 1 (6.7) | 0.7 - 27.2 | ||
| 1> | 31 | 23 (74.2) | 57.1 - 87 | 8 (25.8) | 13- 42.9 | ||
| Tumor Stage | 0.445 | ||||||
| I-II | 31 | 26 (83.9) | 68.2-93.6% | 5 (16.1) | 6.4-31.8% | ||
| III-IV | 15 | 11 (73.3) | 48.3-90.3% | 4 (26.7 | 9.7-51.7% | ||
| Vascular invasion | 0.41 | ||||||
| No | 13 | 12 (92.3) | 69.3-99.2% | 1 (7.7) | 0.8-30.7% | ||
| Yes | 33 | 25 (75.8) | 59.4-87.8% | 8 (24.2) | 12.2-40.6% | ||
| Capsular invasion | 0.41 | ||||||
| No | 13 | 12 (92.3) | 69.3-99.2% | 1 (7.7) | 0.8-30.7% | ||
| Yes | 33 | 25 (75.8) | 59.4-87.8% | 8 (24.2) | 12.2-40.6% | ||
| Extra-thyroid invasion | 0.666 | ||||||
| No | 34 | 28 (82.4) | 67.2 - 92.3 | 6 (17.6) | 7.7 - 32.8 | ||
| Yes | 11 | 8 (72.7) | 43.5 - 91.7 | 3 (27.3) | 8.3 - 56.5 | ||
| Tumor location | 0.637 | ||||||
| Unilateral | 21 | 16 (76.2) | 55.4 - 90.3 | 5 (23.8) | 9.7 - 44.6 | ||
| Bilateral | 9 | 8 (88.9) | 58.6 - 98.8 | 1 (11.1) | 1.2 - 41.4 | ||
| Lymph nodal metastasis | 0.802 | ||||||
| No | 17 | 14 (82.4) | 60-94.8 | 3 (17.6) | 5.2-40% | ||
| Yes | 29 | 23 (79.3) | 62.2-90.9% | 6 (20.7) | 9.1-37.8% | ||
| Total | 46 | 37 (80.4) | 67.3 - 89.9 | 9 (19.6) | 10.1 - 32.7 |
Table 1: BRAFV600E mutation and clinic pathological features in papillary thyroid carcinoma.
Heterozygous BRAFV600E mutations were detected in 8 CD56- negative cases and 1 CD56-positive case. No significant differences in the BRAF mutation and CD56 expression were shown to be associated with prognosis (Table 1) [31].
The risk factors for the BRAFV600E mutation were explored. (Table 2) shows the ORs for positive expression of CD56 (OR=0.295, 95%CI=0.033–2.654, p=0.276, (Figure 1), pathologic tumor stage IIIIV (OR=1.891, 95%CI=0.425–8.406, p=0.403), tumor size greater than 1 cm (OR=4.87, 95%CI=0.549–43.183, p=0.155), presence of lymphatic vascular invasion (OR=3.84, 95%CI=0.43–34.306, p=0.229), presence of tumor capsular invasion (OR=3.84, 95%CI=0.43–34.306, p=0.229), presence of extra thyroidal extension (OR=1.75, 95%CI=0.356– 8.609, p=0.491), and regional lymph node invasion (OR=1.217, 95%CI=0.262–5.661, p=0.802) [32].
Variables |
BRAF(+)/ normal | P value | |
|---|---|---|---|
| OR | 95% CI | ||
| CD 56 (+) | 0.295 | 0.033 - 2.654 | 0.276 |
| Tumor stage III-IV | 1.891 | 0.425-8.406 | 0.403 |
| Tumor size (>1cm) | 4.87 | 0.549 - 43.183 | 0.155 |
| Vascular invasion (+) | 3.84 | 0.43-34.306 | 0.229 |
| Capsular invasion (+) | 3.84 | 0.43-34.306 | 0.229 |
| Extra-thyroid invasion (+) | 1.75 | 0.356 - 8.609 | 0.491 |
| Lymph node metastasis (+) | 1.217 | 0.262-5.661 | 0.802 |
Table 2: The risk factor evaluation of BRAFV600E mutation.
Of the 59 cases examined in the study, the NRAS mutation was positive in only 2 (3.4%) cases of PTC (Figure 3). Both cases of NRAS mutations were classic variants of PTC that did not extend to the extra thyroidal region, and one of these cases was CD56-positive and metastatic to the lymph nodes. However, no significant differences were found between patients with or without NRAS mutations [33].
Discussion
According to the World Health Organization (WHO) annual report, 532,000 new cases of thyroid cancer were diagnosed in 2020, ranking ninth in the total number of cancer cases. In 2020, the number of deaths from thyroid cancer was 43,646, making it the 24th leading cause of cancer-related deaths. By region, the prevalence of thyroid cancer is 59.7% in Asia, 20% in North and South America, and 15% in Europe, with the highest rates in Korea, Canada, and Italy. According to the statistics of the Mongolian National Cancer Center, 32 new cases of thyroid cancer were registered in 2010, but 73 new cases were diagnosed in 2020 [34].
In our study, we included 59 patients diagnosed with thyroid tumors who underwent surgery, and most of these patients (78%) had PTC. The classic variants of PTC were the most prevalent variant and were usually diagnosed in pathologic stages I-II. Although diagnosed early, 33 (71.7%) of all PTCs showed foci of lymphatic vessels and tumor capsule invasion. Among them, 11 (23.9%) cases infiltrated the extra thyroidal soft tissue, and 29 (63%) cases metastasized to the regional lymph nodes [35].
CD56 expression was detected by immunohistochemistry in 87.5% of benign tumors and 27.4% of malignant tumors. This difference in CD56 expression was statistically significant (p=0.002). For PTC alone, CD56 was not expressed in 73.9% (n=34) of cases, including 58.7 % (n=27) of classic cases and 15.2% (n=7) of other variants. These results are similar to those of other previous studies, such as Dunderovic et al. (2015). CD56 expression is correlated with metastatic potential and poor prognosis in some malignant tumors. However, CD56 was considered important in diagnosing follicular neoplasms to distinguish between benign and malignant potential, although we did not significance of these clinic pathological findings related to CD56 expression [36].
In this study, the BRAF V600E mutation was detected in 19.6% of thyroid papillary carcinomas, which is relatively less than reported in previous studies. For example, the BRAFV600E mutation was detected in 31.6% and 86.7% of thyroid papillary carcinomas in Stanojevic et al. (2011) and Huang et al. (2019), respectively. Thus, BRAF mutations may be commonly detected in countries such as Korea, China, Australia and Argentina, with relatively high thyroid cancer incidence rates. Our study has some limitations that may have influenced our results [37]. Because Mongolia has a small population of 3 million, the incidence of thyroid cancer is lower than in countries with large populations, so it was possible to include a small number of specimens in our study. The National Cancer Center is the only major cancer surgery hospital in Mongolia, and we did not include cases of inadequate patient information and poor quality of stored paraffin blocks. In addition, most of the materials used in our study contained FFPE tissue, which may have influenced the sequencing results. Furthermore, BRAF mutations were detected in thyroid cancer at a lower rate than in other countries, possibly due to the low radiation exposure in Mongolia. However, there is still a lack of research on the risk and causes of thyroid cancer in Mongolia [38].
In this study, no significant differences were found in sex, age, tumor size and multimodality between patients with or without BRAFV600E mutations, similar to the findings of multiple previous studies. In the abovementioned studies, the BRAFV600E mutation was typically identified in classical and tall cell variants. However, it was rarely identified in the follicular variant. Additionally, in our study, all cases with the BRAFV600E mutation were related to classical variants. On the other hand, there were differences in histological type, lymph node metastasis, tumor stage, and extra thyroidal extension between these 2 groups in other studies. However, these differences were not observed in our study [39].
There was a correlation between the BRAFV600E mutation and increased PTC aggressiveness in studies carried out in the USA6), Italy, Turkey. However, there was no correlation found between the BRAFV600E mutation and increased PTC aggressiveness in studies carried out in Japan, Korea Taiwan, France, Russia and some studies in Italy. In addition, there was no correlation found in our study.
In our study, NRAS mutations were detected in 3.38% of PTCs, which is much less than other studies reported. Additionally, there was no correlation between the clinic pathological features and NRAS mutation (exon 3) in our study or other studies [40].
Conclusion
In conclusion, BRAFV600E and NRAS mutations were detected in 19.6% and 3.38% of PTC cases, respectively, in our study. We found no correlation between BRAFV600E and NRAS mutations and increased PTC aggressiveness.
Acknowledgment
This study was funded by a research grant (17/01/01) from the Division of Science and Technology, Mongolian National University of Medical Sciences (MNUMS). The authors thank the ERASMUSARROW project team for supporting our scientific database (AR1- WP3) online training.
References
- Liang J, Cai W, Feng D, Teng H, Mao F, et al. (2018) . J Pathol 244: 215-226.
- Liu RT, Chen YJ, Chou FF, Li CL, Wu WL, et al. (2005) . Clin Endocrinal (Oxf) 63: 461-466.
- Sahpaz A, Onal B, Yesilyurt A, Han U, Delibasi T, et al. (2015) . Balkan Med J 32: 156-166.
- Aboelnaga EM, Ahmed RA (2015) . Cancer Biol Med 12: 53-59.
- Tiangui H, Jian Z, Wenyong WZ (2013) . Biomark Res 1: 1-6.
- Melck A L, Yip L (2012) . Head Neck 34: 1355-1361.
- Bhaijee F, Nikiforov YE (2011) . Endocr Pathol 22: 126-133.
- Rashid FA, Fukuoka J, Bychkov A (2020) . Gland Surg 9: 1878-1900.
- Pyo JS, Kim DH, Yang J (2018) Int J Biol Markers 33: 161-167.
- Crnic I, Strittmatter K, Cavallaro U, Kopfstein L, Jussila L, et al. (2004) . Cancer research 64: 8630-8638.
- Dunderovic D, Lipkovski JM, Boricic I, Soldatovic I, Bozic V, et al. (2015) . Diagn Pathol 10: 196.
- Shin MK, Kim JW, Ju Y-S (2011) . J Korean Med Sci 45.
- Allred DC, Harvey JM, Berardo M, Clark GM (1998) official journal of the United States and Canadian Academy of Pathology. Inc 11: 155-168.
- Frasca F, Nucera C, Pellegriti G, Gangemi P, Attard M, et al. (2008) . Endocr Relat Cancer 15: 191-205.
- Nikiforova MN, Lynch RA, Biddinger PW, Alexander EK, Dorn GW, et al. (2003) J Clin Endocrinol Metab 88: 2318-2326.
- Siegel RL, Miller KD, Jemal A (2019) J Clin 69:7-10.
- Chen X, Guo C, Cui W, Sun K, Wang Z, et al, (2020) CD56 Cancer Manag Res 12: 4625-4631.
- Stanojevic B, Dzodic R, Saenko V, Milovanovic Z, Pupic G, et al. (2011) . Endocrine journal 58: 381-393.
- Huang M, Yan C, Xiao J, Wang T, Ling R, et al. (2019) . Diagn Pathol 14: 74.
- Ahn D, Park JS, Sohn JH, Kim JH, Park SK, et al. (2012) . Auris Nasus Larynx 39: 198-203.
- Ito Y, Yoshida H, Maruo R, Morita S, Takano T, et al. (2009) . Endocrine journal 56: 89-97.
- Mond M, Alexiadis M, Fuller P J, Gilfillan C (2014) . Intern Med J 44: 727-734.
- Nasirden A, Saito T, Fukumura Y, Hara K, Akaike K, et al. (2016) . Virchows Arch 469: 687-696.
- Kurtulmus N, Duren M, Ince U, Cengiz Yakicier M, Peker O, et al. (2012) Endocrine 42: 404-410.
- Sun J, Zhang J, Lu J, Gao J, Ren X, et al. (2016) . PLoS One 11: 153-319.
- Jin L, Sebo TJ, Nakamura N, Qian X, Oliveira A, et al. (2006) . Diagn.Mol Pathol 15.
- Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, Knauf JA, et al. (2003) . J Clin Endocrinol Metab 88: 5399-5404.
- Rodolico V, Cabibi D, Pizzolanti G, Richiusa P, Gebbia N, et al. (2007) s. Cancer 110: 1218-1226.
- Elisei R, Ugolini C, Viola D, Lupi C, Biagini A, et al. (2008) . J Clin Endocrinol Metab 93: 3943-3949.
- Lupi C, Giannini R, Ugolini C, Proietti A, Berti P, et al. (2007) . J Clin Endocrinol Metab 92: 4085-4090.
- Jo YS, Li S, Song JH, Kwon KH, Lee JC, et al. (2006) . J Clin Endocrinol Metab 91: 3667-3670.
- Zoghlami A, Roussel F, Sabourin JC, Kuhn JM, Marie JP, et al. (2014) . Eur Ann Otorhinolaryngol Head Neck Dis 131: 7-13.
- Abrosimov A, Saenko V, Rogounovitch T, Namba H, Lushnikov E, et al. (2007) . Int J Cancer 120: 196-200.
- Durante C, Puxeddu E, Ferretti E, Morisi R, Moretti S, et al. (2007) J Clin Endocrinol Metab 92: 2840-2843.
- Fugazzola L, Puxeddu E, Avenia N, Romei C, Cirello V, et al. (2006) Endocr Relat Cancer 13: 455-464.
- Sapio MR, Posca D, Troncone G, Pettinato G, Palombini L, et al. (2006) . Eur J Endocrinol 154: 341-348.
- Bastos AU, Oler G, Nozima BH, Moyses RA, Cerutti JM, et al. (2015) . Eur J Endocrinol 173: 525-540.
- Zou M, Baitei EY, Alzahrani AS, BinHumaid FS, Alkhafaji D, et al. (2014) . Thyroid 24: 1256-1266.
- Jang EK, Song DE, Sim SY, Kwon H, Choi YM, et al. (2014) . Thyroid 24: 1275-1281.
- Fakhruddin N, Jabbour M, Novy M, Tamim H, Bahmad H, et al. (2017) . Sci Rep 7: 46-66.
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
r ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
, ,
r ,
, ,
, ,
, ,
, ,
Citation: Enkhbat B, Okdoo S (2023) The BRAF, NRAS Mutations and Clinicpathologicalfeatures of Thyroid Tumors in Mongolia. J Cancer Diagn 7: 172.
Copyright: © 2023 Enkhbat B, et al. This is an open-access article distributedunder the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided theoriginal author and source are credited.
Select your language of interest to view the total content in your interested language
Share This Article
Recommended Journals
Open Access Journals
Article Usage
- Total views: 5419
- [From(publication date): 0-2023 - Jul 26, 2026]
- Breakdown by view type
- HTML page views: 4974
- PDF downloads: 445



