Shruti Chatterjee1* and Soumya Haldar2
1National Institute of Oceanography, Regional Centre, Lokhandwala Road, Four Bungalows, Andheri (West), Mumbai, India
2Discipline of Marine Biotechnology and Ecology, Central Salt and Marine Chemicals Research Institute (CSIR), GB Marg, Bhavnagar, Gujarat, India
Received date: September 21, 2011; Accepted date: April 21, 2012; Published date: April 23, 2012
Citation: Chatterjee S, Haldar S (2012) Vibrio Related Diseases in Aquaculture and Development of Rapid and Accurate Identification Methods. J Marine Sci Res Dev S1:002. doi:10.4172/2155-9910.S1-002
Copyright: © 2012 Chatterjee S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Visit for more related articles at Journal of Marine Science: Research & Development
Vibrios; Molecular techniques; PCR; 16S rRNA; FISH; AFLP; RAPD
PCR: Polymer Chain Reaction; AFLP: Amplified Fragment Length Polymorphism; FISH: Fluorescence In Situ Hybridization; RAPD: Random Amplified Polymorphic DNA; rep- PCR: Repetitive extragenic palindrome–PCR; RFLP: Restriction Fragment Length Polymorphism; VBNC: Viable But Non Culturable; FISHCH: FISH Following Cultivation
Aquaculture remains a growing, vibrant and important production sector for high animal protein food that is easily digestible and of high biological value. Globally, marine and inland capture fisheries provide two-thirds of the total food fish supply and the remaining one-third being derived from aquaculture [1]. The reported global production of food fish from aquaculture, including fin fishes, crustaceans, molluscs and other aquatic animals for human consumption, reached a staggering height of 52.5 million tons in 2008. The contribution of aquaculture to the total production of capture fisheries and aquaculture continued to grow, rising from 34.5% in 2006 to 36.9% in 2008. In the period 1970-2008, the production of food fish from aquaculture increased at an average annual rate of 8.3% according to The state of World fisheries and aquaculture 2010 [2].
However, major setback in aquaculture is the sudden outbreak of diseases, especially caused by Vibrio spp. which is considered as a significant problem to the development of the sector with severe economic losses worldwide. Global estimation of disease losses, made by the World Bank in 1997, was the range of approximately US$ 3 billion per year [3]. Vibrio harveyi, Vibrio anguillarum are most frequently isolated marine Vibrio species [4-7], have been associated with large-scale losses of larval and juvenile penaeids [8] and also causing several opportunistic diseases to fishes [9-13]. Due to the plasticity of Vibrio genomes, with frequent horizontal gene transfer events, species boundaries are very narrow in the marine environment [14]. Hence, the identification of Vibrio related species isolated from the marine environment is sometimes tricky. An array of phenotypic and genomic techniques has become available for the identification of vibrios in the last three decades [15-22]. Accurate identification is the basic step for developing appropriate prophylactic measures in any aquaculture settings. In the present study a detailed review was undertaken to study on the diseases caused by vibrios in aquaculture settings and some of the important modern techniques to identify the disease causing organisms accurately.
Vibrios are gram-negative, ubiquitous in marine, estuarine ecosystem as well as aquaculture farm and one of the major microbiota of these ecosystems. Many vibrios are serious pathogens for animals reared in aquaculture [23-27]. Vibriosis is a most prevalent disease in fishes and other aquaculture reared organisms caused by Vibrio spp. and widely responsible for mortality for cultured aquaculture organisms worldwide [28,29]. Major Vibrio sp. viz. V. harveyi, V. parahaemolyticus, V. alginolyticus, V. anguillarum, V. vulnificus, and V. splendidus are usually associated with shrimp diseases. V. harveyi is associated with luminescent vibriosis in shrimps e.g., Litopenaeus vannamei and Penaeus monodon and it is most important etiological agent for mass mortality in P. monodon [28,30-32]. It has been reported that V. anguillarum, V. salmonicida, and V. vulnificus are among the main bacterial pathogens in several fish species [26]. The mode of infection in fish mainly consists of penetration of bacterium to the host tissue mainly by the chemotactic activity, followed by deployment of iron sequestering system and eventually damages the fish by means of extracellular products i.e. haemolysin and protease. In a recent study, mucus secretion, blood clots were reported to be common symptoms for moribund seabream (Sparus aurata) isolated from a hatchery located in Malta [33]. Details investigation concluded the infection might be due to haemolysin activity of V. harveyi infection. Some of the common symptoms of disease in fish caused by strains of pathogenic vibrios include intestinal nacrosis, anemia, ascetic fluid, petechial hemorriages in the muscle wall, liquid in the air bladder etc. It has been reported that shrimps are also infected by vibrios and the possible route of infection are feed, gill, hepatopancreas etc. Vibrios colonized the host tissue of shrimps after crossing the epithelial cells [34]. Some of the important aquaculture diseases caused by different Vibrio sp. are described in (Table 1). Although marine vibrios were reported to be main cause for bacterial disease in aquaculture, an important challenge for understanding the virulence potential of marine Vibrio and its mechanism for causing disease in a simple and reliable animal model is lacking. Recently, the brine shrimp, Artemia nauplii has been used in many studies mainly because of its simple culture method in gnotobiotic condition [35]. Bacterial interaction or colonization with challenged organisms is a very complex mechanism. To study the colonization potentials, several techniques have been employed such as use of cell lines [36], direct observation with scanning electron microscopy etc. [37]. These processes involve fixation and preparation of samples for microscopy, but do not permit observations in-vivo or on recently killed organisms, or guarantee that the observed bacteria are those inoculated or of interest. Thus, in-vivo colonization potential after labeling a pathogenic Vibrio strain with fluorescent dye was considered to be an appropriate method to study the colonization potential in-vivo. In a recent study Haldar et al. [38] have established pathogenic potential of a handful numbers of V. campbellii isolates, marine bacterial species, which was previously considered to be a nonpathogenic Vibrio [38].
| Vibrio spp. caused disease | Host organism | Disease | PCR based diagnostic method | Reference |
|---|---|---|---|---|
| Vibrio harveyi V. alginolyticus V. parahaemolyticus V. anguillarum V. vulnificus V. ordalii V. salmonicida Moritella viscosa (Vibrio viscosus) | Peneause monodon (Tiger prawn) Litopenaeus vannamei (White shrimp) Epinephelus coioides (Grouper) Sulculus diversicolor (Japanese abalone) P. monodon (Tiger prawn) P. monodon (Tiger prawn) Salmo salar L. (Salmon), Oncorhynchus mykiss (Rainbow trout) Oreochromis niloticus (Nile tilapia), Eels Salmonids Atlantic salmon, cod Atlantic salmon, cod |
Luminescent vibriosis resulting in mass mortality Up to 85% mortality in nauplii Gastroenteritis followed by mass mortality Mass mortality Shell disease Red disease, upto 80% mortality Vibriosis Vibriosis Vibriosis Vibriosis Winter ulcer |
Yes Yes Yes Yes Yes No No No | [84] [36] [85] [86] [87] [88] [88] [89] [90] [91] [90] [90] [90] [90] |
Table 1: Disease caused by Vibrio spp. in aquaculture.
In recent past intensive mode of culture with high stocking density become popular in different south east Asian countries like Thailand, Indonesis, Philippines etc. To maintain the productivity of such an intensive aquaculture, high input of fish protein originating from the sea have been employed for feeding, together with high level of water exchange and massive use of antibiotics. The spread of antibiotic resistance from aquaculture settings to natural environment is increasing. About 70% of the Vibrio isolated from aquaculture settings in Mexico are multi drug resistant [39]. On the other hand some of the important negative environmental impacts include loss of wild fishes (5 kg of wild fish has to be caught to feed 1 kg of carnivorous fish reared), loss of natural habitat, effluent discharge and destruction of sensitive habitat [40,41]. Ben-Haim et al. [41] in 2003 have advanced the hypothesis that aquaculture settings serve as foci or reservoir for pathogenic Vibrio strains, during certain period of the year, pathogenic Vibrio would withstand environmental conditions within aquaculture settings and when favourable environmental conditions established, Vibrio would be able to cause disease in wild animal [42].
Due to increasing trend of antibiotic resistance in aquaculture many alternative methods were in use by aquaculture scientist in recent time to reduce Vibrio related diseases. Among many others, some of the popular methods were use of probiotic, immunestimulants.
An array of molecular techniques is gaining popularity now-adays for the identification of different aquaculture related bacterial pathogens. SuiTable genetic fingerprinting methods are essential for rapid and accurate tracking of different marine vibrios. Among DNA sequence based identification, analysis of 16S rRNA and other housekeeping gene sequencing are most popular and precise methods use now-a-days to identify closely related Vibrio. Among other methods, ribotyping and PCR-based techniques, e.g., Amplified Fragment Length Polymorphism (AFLP), Fluorescence In Situ Hybridization (FISH), Random Amplified Polymorphic DNA (RAPD), repetitive extragenic palindrome (rep) –PCR (rep-PCR), and Restriction Fragment Length Polymorphism (RFLP) have also yielded the most valuable information about and new insights into the identification of closely related marine bacteria. Below we have discussed some of these methods commonly used for identification:
PCR based identification
Although there is a handful numbers of methods for identification of marine Vibrio as described above but majority of them require two or more step approaches like PCR and sequencing (16S rRNA and MLST) PCR and digestion with restriction enzymes (PCR-RFLP, AFLP) or use of radio isotope labelled probe which is expensive, time consuming and also comparatively hazardous for health. Simple and rapid identification method of Vibrio causing disease to aquaculture settings is essential for taking preventive and curative measures in aquaculture. PCR-based identification is a suiTable alternative because it is comparatively easy, less expensive and can be completed within several hours [43]. However, success of this method depends on the selection of target gene, which should be species-specific, widely distributed and also sTable in the genome.
Maximum works have been reported to identify V. harveyi related marine bacteria using PCR. Because V. harveyi is the major causal organism of luminous vibriosis, which causes potential devastation to diverse ranges of marine invertebrates over a wide geographical area. These microorganisms, however, are extremely difficult to identify because they are phenotypically diverse. Recently in 2006, Bramhachari and Dubey [44] developed PCR based identification method for V. harveyi targeting partial 16S rRNA gene [44]. Further Fukui and Sawabe [45] have modified the method by developing one step colony PCR targeting same 16S rRNA gene to identify pathogenic V. harveyi from aquaculture settings [45]. Similarly, Conejero and Hydryda [46] in 2003 have targeted toxR gene for identification of V. harveyi from aquaculture system [46]. However, most precise method to identify V. harveyi along with V. campbellii and was developed by Haldar et al. [47] in 2010, using multiplex PCR. This method was so accurate that the individual detection limit of all three-target species ranged from 10 to 100 cells per PCR tube, using primer concentration of 0.25 to 0.5 μmol/l (Figure 2a and 2b) [47]. Details of PCR primers for identification of some important marine Vibrio were mentioned in (Table 2). Photobacterium damselaessp. Damselae and Photobacterium damselae ssp. Piscida are important aquaculture pathogens which are responsible for causing fish disease, photobacteriosis, also known as pasteurellosis or pseudotuberculosis. High mortalities of P. piscicida infection were first observed in natural population of white perch (Morone americanus) and striped bass (Morone saxatalis) [48,49]. Photobacterium damselae ssp. which was formerly classified as V. damsela is a halophilic bacterium causing skin ulcers in warm and cold water fish [50-53]. In 2003, Rajan et al. [54] have developed a common PCR based method to identify both P. damselae ssp. Damselae and P. damselae ssp. Piscida targeting capsular polysaccharide gene and further differentiate both the species by selective culturing in on thiosulphate citrate bile salts–sucrose agar (TCBS-1) [54]. P. damselae ssp. Damselae grew on TCBS-1 producing green colonies whereas P. damselae ssp. Piscicida did not grow.
| Primer | Sequence (5'-3') | Target species | Expected bandsize (bp) | Acc. Number | References |
|---|---|---|---|---|---|
| Vca-hly5 | CTATTGGTGGAACGCAC | V. campbellii | 328 | AB271112 | [73] |
| vca-hly3 | GTATTCTGTCCATACAAAC | ||||
| Vh-hly 1F | GAGTTCGGTTTCTTTCAAG | V. harveyi | 454 | DQ224369 | [73] |
| Vh-hly 1R | TGTAGTTTTTCGCTAATTTC | ||||
| Vp-tlh1 | GATTTGGCGAACGAGAAC | V. parahaemolyticus | 695 | M36437 | [73] |
| Vp-tlh2 | CGTCTCGAACAAGGCG | ||||
| VctoxR403F | GAAGCTGCTCATGACATC | V. cholerae | 275 | CP000627 | [69] |
| VctoxR678R | AAGATCAGGGTGGTTATTC | ||||
| WhA870F | ACTCAACTATCGTGCACG | V. vulnificus | 366 | AB124802 | [69] |
| WhA1236R | ACACTGTTCGACTGTGAG | ||||
| Vng F2 | CCCGAACGAAGCGAAA | V. nigripulchritudo | 258 | [92] | |
| VngR2 | ACCTTTCAGTGGCAAGATG | ||||
| CPS F | AGGGGATCCGATTATTACTG | Photobacterium damselae | 410 | AB074290 | [80] |
| CPS R | TCCCATTGAGAAGATTTGAT | sp. Piscicida | |||
| F-gyrB | ATTGAGAACCCGACAGAAGCGAAG | V. alginoloticus | 340 | AF007288 | [93] |
| R-gyrB | CCTAATGCGGTGATCAGTGTTACT | ||||
| HG-F1 | GCTCTGTCGGAAAACTTGA | Grimontia hollisae | 363 | AB027462 | [94 |
| HG-R1 | ATGCTCAAAATGGAACACAG | ||||
| Vc_dnaJF1 | CGGTTCGYGGTGTTTCAAAA | V. coralliilyticus | 128 | [95] |
Table 2: PCR primers for identification of some important marine Vibrio.
Figure 2a: Specificity of the hly gene-based multiplex PCR. Lanes 1 and 7 are a 100 bp ladder (Takara Bio Inc.); 2, Vibrio campbellii ATCC 25920T; 3, Vibrio harveyi ATCC 12126T; 4, Vibrio parahaemolyticus NBRI 12711T; 5. V. campbellii, V. harveyi and V. parahaemolyticus; 6, E. coli C600. PCR products (5 μl each) were analysed by 1.5% agarose gel electrophoresis and visualized after ethidium bromide staining using Gel-Doc 2000 (Bio- Rad, CA, USA).
Figure 2b: Detection limit of the hly gene-based multiplex PCR. (b) Lanes: 1 and 14 are a 100 bp ladder (Takara Bio Inc.); 2, V. campbellii 104 CFU, 3, V. campbellii 103 CFU; 4, V. campbellii 102 CFU; 5, V. campbellii 101 CFU; 6, V. harveyi 104 CFU; 7, V. harveyi 103 CFU; 8, V. harveyi 102 CFU; 9, V. harveyi 101 CFU; 10, V. parahaemolyticus 104 CFU; 11, V. parahaemolyticus 103 CFU; 12, V. Parahaemolyticus 102 CFU, 13, V. Parahaemolyticus 101 CFU. PCR products (5μl each) were analysed by 1.5% agarose gel electrophoresis and visualized after ethidium bromide staining using Gel- Doc 2000 (Bio-Rad, CA, USA).
16S rRNA and housekeeping gene based identification
16S rRNA gene sequencing is considered to be very reliable method for identification of any bacteria including marine Vibrio by many authors [55-60]. The 16S rRNA gene (about 1,500 bp in length) consists of highly conserved regions and present in almost all bacteria which may reveal deep-branching (e.g., classes, phyla) relationships but variable regions may also be demonstrated which can discriminate species within the same genus. This feature has prompted researchers to use 16S rRNA both as a phylogenetic marker and as an identification tool [61].
Colony hybridization by species-specific probes
It has been demonstrated that different selective media are not quite selective or species-specific. Detection of different marine bacteria on selective media and subsequent colony hybridization with species-specific probes (probe is a fragment of DNA or RNA of variable length, which is used in DNA or RNA samples to detect the presence of nucleotide sequences), based on variable target regions of the 16S rRNA gene and other specific gene has been evaluated as a fast screening alternative tool for identification of different marine bacteria [62-66]. However, there is nearly 100% 16S rRNA gene homology among many closely related bacterial species, viz. V. scophthalmi and V. ichthyoenteri and thus there is a great possibility of cross-hybridization and misidentification of closely related species [64].
Fluorescent in situ hybridization
Fluorescent In Situ Hybridization provides a powerful tool for identifying the location of cloned DNA sequence by using fluorescence probe binds to that part of chromosomes with which they show higher degree of similarity and often used in the field of microbial ecology [67]. It has been reported that certain bacteria are metabolically active however may not be able to grow on the selective media e.g., V. cholera. Nutrient limitation or starvation, variation of pH, salinity and temperature could lead to such stage, for which they proposed the name “viable but non culturable” (VBNC) [56,68]. VBNC form of marine bacteria can be identified by direct extraction of nucleic acids from environmental samples (e.g. water, tissue, sediment etc.), followed by clonal library and 16S rRNA sequencing or alternative FISH of filter fixed cells with oligonucleotide probes targeting the 16S rRNA and subsequent visualization by epifluorescent microscopy. The low fluorescence intensity of marine bacteria is one of the main drawbacks of FISH technology [69,70]. On the other hand, because several Vibrio species (e.g. V. harveyi, V. campbellii, V. rotiferianus, and other closely phylogenetic neighbours) have very similar 16S rRNA sequences, it may be difficult to perform reliable species identification. Recently, one-step multi probe FISH method has been developed. In short, FISH method has combined with microcolony formation culture and known as FISH following cultivation (FISHFC). It has the advantage of increasing not only the specificity of probes but also the development of microcolonies in selective media within a short time which increases its applicability. A probe-reacted to the microcolonies and generate stronger fluorescence signals rather than for single colony [71]. In FISHFC variety of group or species-specific probe can be used.
Ribotyping
Ribotyping was one of the first fingerprinting techniques to be successfully used in the taxonomy of vibrios, and it has been particularly useful in the study of V. cholerae [72,73]. This technique is mainly used for epidemiological purposes. More recently, ribotyping has been used to assess the genomic diversity of environmental Vibrio strains associated with fish and oysters [74]. According to Austin et al. [75], closely related Vibrio species, e.g., V. anguillarum and V. ordalii, can be differentiated on the basis of ribotyping [75]. In another recent study Haldar et al. [38] have successfully differentiate two very closely related Vibrio species such as V. harveyi and V. campbellii using ribotyping method (Figure 1). Ribotyping consists of four main steps: (i) restriction of the bacterial chromosome with an endonuclease, (ii) gel electrophoresis of the resulting fragments, (iii) transfer of the fragments to a membrane, and (iv) hybridization of the gel with a labelled probe complementary to the 16S and 23S rRNAs [72]. This method is very sensitive but comparatively lengthy.
Figure 1: Ribotype pattern of test strains along with V.harveyi (AM15) and V.parahaemolyticus (VP61) standard strains after digestion with BglI restriction enzyme. Differences in band positions are indicated by arrows (â�?º). Three clusters are identified by solid line (Cluster I), square dot (Cluster II) and dashed line (Cluster III).
Restriction Fragment Length Polymorphism (RFLP)
Restriction Fragment Length Polymorphism or RFLP is a technique that exploits variations in homologous DNA sequences. It refers to a difference between samples of homologous DNA molecules that come from differing locations of restriction enzyme sites, and to a related laboratory technique by which these segments can be illustrated. In RFLP analysis, the DNA sample is broken into pieces (digested) by restriction enzymes and the resulting restriction fragments are separated according to their lengths by gel electrophoresis. Simple and rapid RFLP method was developed by Saha et al. [76] in 2006, based on chromosomal ori sequence of V. cholerae. It was effective to delineate between two closely related biotypes of pathogenic Vibrio strains. In a recent study, Chowdhury et al. [77], has developed an RFLP method targeting some parts of super integron region of . genome showed good delineation between different biotype of V. cholerae strains.
Amplified Fragment Length Polymorphism (AFLP)
The AFLP is another successful PCR assay based method for differentiating the closely related Vibrio species. The AFLP method consists of mainly three steps: (i) digestion of total genomic DNA with two restriction enzymes and subsequent ligation of the restriction half-site-specific adaptors to all restriction fragments; (ii) selective amplification of these fragments with two PCR primers that have corresponding adaptor and restriction site sequences as their target sites; and (iii) electrophoretic separation of the PCR products on polyacrylamide gels with selective detection of fragments which contain the fluorescently labeled primer and computer-assisted numerical analysis of the band patterns [55]. Actually radioactively labeled primers were originally used in 1995 by Vos et al. [78] but fluorescent based primers used for performing AFLP now.
Random Amplified Polymorphic DNA (RAPD)
RAPD is a rapid, powerful and inexpensive PCR method, using arbitrary primers to detect the segment of DNA in genome. No knowledge for the DNA sequence of the targeted gene is required, as the primers will bind somewhere in the sequence is not certain. In recent years, RAPD has been used to characterize, and trace the phylogeny of diverse plant and animal species. In V. harveyi it has been used to differentiate pathogenic and non-pathogenic strain and having the ability of making different cluster whereas in other Vibrios for diversity study [79-81]. Some of the main drawback of this method includes PCR is an enzymatic reaction, therefore the quality and concentration of template DNA, concentrations of PCR components, and the PCR cycling conditions may greatly influence the outcome. Thus, the RAPD technique is notoriously laboratory dependent and needs carefully developed laboratory protocols to be reproducible.
In the present study all the bacterial identification were based on culturing the strain in suiTable media, followed by extraction of DNA and final identification based on the diversity of DNA sequences. No emphasis was given to identify non culturable Vibrio which comprises major percentage of total Vibrio population except in FISH. The rapid development of molecular biological techniques offers significant advantages for workers involved in fish disease diagnosis. Using nucleic acid as targets, and new methods of analysing polymorphism in these nucleic acids, can improve specificity, sensitivity and speed of diagnosis and offer means of examining the relationships between genotype and phenotype of various pathogens. Further investigation and explanation of the biodiversity among marine Vibrios by using new molecular techniques will be an important topic for future research. In recent years, the number of new publications describing new molecular techniques or methods has increased significantly. Such publications describe the development of new methods that appear very promising and useful. However, reports of application of these techniques on a routine basis in diagnostic laboratories are few. In order for molecular biology to fulfil the promise of improved diagnosis and to be adopted by regulatory authorities, thorough trials of new methods are required and the results of these must be disseminated. Molecular methods have slowly established a place in the diagnosis of disease in aquaculture.
We are thankful to Dr S R Shetye Director NIO, Dr S. N. Gajbhiye, chief scientist, NIO and Dr. N. Ramaiah, chief scientist, NIO for extending permission, providing facilities and encouragement to complete this review article. This is NIO contribution number 5076.
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals